Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU078571

Sigma-Aldrich

MISSION® esiRNA

targeting human CYLD

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCCTCCTCCTGTGAACTCACTGACCACCGAGAACAGATTCCACTCTTTACCATTCAGTCTCACCAAGATGCCCAATACCAATGGAAGTATTGGCCACAGTCCACTTTCTCTGTCAGCCCAGTCTGTAATGGAAGAGCTAAACACTGCACCCGTCCAAGAGAGTCCACCCTTGGCCATGCCTCCTGGGAACTCACATGGTCTAGAAGTGGGCTCATTGGCTGAAGTTAAGGAGAACCCTCCTTTCTATGGGGTAATCCGTTGGATCGGTCAGCCACCAGGACTGAATGAAGTGCTCGCTGGACTGGAACTGGAAGATGAGTGTGCAGGCTGTACGGATGGAACCTTCAGAGGCACTCGGTATTTCACCTGTGCCCTGAAGAAGGCGCTGTTTGTGAAACTGAAGAGCTGCAGGCCTGACTCTAGGTTTGCATCATTGCAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tadaatsu Imaizumi et al.
Kidney & blood pressure research, 42(5), 942-950 (2017-11-23)
Cylindromatosis (CYLD), a deubiquitinase, negatively regulates nuclear factor-κB in various cells. However, its potential roles in glomerular inflammation remain unclear. Because the activation of the Toll-like receptor 3 (TLR3)/type I interferon (IFN) pathways plays a pivotal role in chronic kidney
Suruchi N Schock et al.
Cell death and differentiation, 24(4), 615-625 (2017-01-07)
Necroptosis is a form of necrotic cell death that requires the activity of the death domain-containing kinase RIP1 and its family member RIP3. Necroptosis occurs when RIP1 is deubiquitinated to form a complex with RIP3 in cells deficient in the
Yuki Imaizumi et al.
Biochemical and biophysical research communications, 508(4), 1168-1174 (2018-12-18)
Cardiovascular disease is one of the leading causes of death in the elderly, and novel therapeutic targets against atherogenesis are urgent. The initiation of atherosclerotic changes of monocyte adhesion on the vascular endothelium and subsequent foam cell formation are noteworthy
Ming Zhao et al.
Cancer medicine, 9(3), 1196-1208 (2019-12-21)
According to the global cancer statistic, lung cancer is one of the most dangerous tumors, which poses a serious threat to human health. Exploration the mechanism of lung cancer and new targeted therapeutic measures is always the hot topic. Long
Kensei Komatsu et al.
Journal of immunology (Baltimore, Md. : 1950), 204(4), 933-942 (2020-01-05)
Otitis media (OM) is the most common bacterial infection in children. It remains a major health problem and a substantial socioeconomic burden. Streptococcus pneumoniae (S. pneumoniae) is one of the most common bacterial pathogens causing OM. Innate inflammatory response plays

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico