Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU072201

Sigma-Aldrich

MISSION® esiRNA

targeting human LONP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGCAATGAGTCGGATGTGGTCGAGAGCCTGGATGAAATCTACCACACGGGGACGTTTGCCCAGATCCATGAGATGCAGGACCTTGGGGACAAGCTGCGCATGATCGTCATGGGACACAGAAGAGTCCATATCAGCAGACAGCTGGAGGTGGAGCCCGAGGAGCCGGAGGCGGAGAACAAGCACAAGCCCCGCAGGAAGTCAAAGCGGGGCAAGAAGGAGGCGGAGGACGAGCTGAGCGCCAGGCACCCGGCGGAGCTGGCGATGGAGCCCACCCCTGAGCTCCCGGCTGAGGTGCTCATGGTGGAGGTAGAGAACGTTGTCCACGAGGACTTCCAGGTCACGGAGGAGGTGAAAGCCCTGACTGCAGAGATCGTGAAGACCATCCGGGACATCATTGCCTTGAACCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Olga Zurita Rendón et al.
Molecular and cellular biology, 38(20) (2018-08-01)
LONP1, an AAA+ mitochondrial protease, is implicated in protein quality control, but its precise role in this process remains poorly understood. In this study, we have investigated the role of human LONP1 in mitochondrial proteostasis and gene expression. Depletion of
Shiyuan Huang et al.
American journal of physiology. Cell physiology, 319(6), C1020-C1028 (2020-09-17)
Myoblast differentiation is a crucial process for myogenesis. Mitochondria function as an energy-providing machine that is critical to this process, and mitochondrial dysfunction can prevent myoblasts from fusing into myotubes. However, the molecular mechanisms underlying the dynamic regulation of mitochondrial
Marie Lagouge et al.
PLoS genetics, 11(8), e1005423-e1005423 (2015-08-08)
We have studied the in vivo role of SLIRP in regulation of mitochondrial DNA (mtDNA) gene expression and show here that it stabilizes its interacting partner protein LRPPRC by protecting it from degradation. Although SLIRP is completely dependent on LRPPRC

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico