Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU069931

Sigma-Aldrich

MISSION® esiRNA

targeting human BTRC

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTGTGCCAGACTCTGCTTAAACCAAGAAACAGTATGTTTAGCAAGCACTGCTATGAAGACTGAGAATTGTGTGGCCAAAACAAAACTTGCCAATGGCACTTCCAGTATGATTGTGCCCAAGCAACGGAAACTCTCAGCAAGCTATGAAAAGGAAAAGGAACTGTGTGTCAAATACTTTGAGCAGTGGTCAGAGTCAGATCAAGTGGAATTTGTGGAACATCTTATATCCCAAATGTGTCATTACCAACATGGGCACATAAACTCGTATCTTAAACCTATGTTGCAGAGAGATTTCATAACTGCTCTGCCAGCTCGGGGATTGGATCATATTGCTGAGAACATTCTGTCATACCTGGATGCCAAATCACTATGTGCTGCTGAACTTGTGTGCAAGGAATGGTACCGAGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kazunori Hashimoto et al.
Antioxidants & redox signaling, 25(17), 953-964 (2016-06-02)
Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2) is the master transcriptional regulator of antioxidant gene expression. On increased oxidative stress, an adaptor for Nrf2 degradation, Kelch-like ECH-associated protein 1 (Keap1), is directly modulated by oxidants in the cytoplasm, which
Zhitian Shi et al.
Digestive diseases and sciences, 61(3), 785-794 (2015-11-02)
There is increasing evidence that histidine triad nucleotide-binding protein 1 (HINT1) is a novel tumor suppressor. In the present study, we investigated the mechanism by which HINT1 promotes the stability of inhibitor of NF-κB α (IκBα) in the cytoplasm of
Qijia Yan et al.
Oncotarget, 6(39), 41766-41782 (2015-10-27)
Epstein-Barr virus (EBV) infection is closely associated with tumorigenesis and development of nasopharyngeal carcinoma (NPC), but the underlying molecular mechanisms remain poorly understood. It has been recently reported that EBV encodes 44 mature miRNAs, some of which were found to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico