Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU067311

Sigma-Aldrich

MISSION® esiRNA

targeting human NFKB2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCAAGAGGCCAAAGAACTGAAGAAGGTGATGGATCTGAGTATAGTGCGGCTGCGCTTCTCTGCCTTCCTTAGAGCCAGTGATGGCTCCTTCTCCCTGCCCCTGAAGCCAGTCATCTCCCAGCCCATCCATGACAGCAAATCTCCGGGGGCATCAAACCTGAAGATTTCTCGAATGGACAAGACAGCAGGCTCTGTGCGGGGTGGAGATGAAGTTTATCTGCTTTGTGACAAGGTGCAGAAAGATGACATTGAGGTTCGGTTCTATGAGGATGATGAGAATGGATGGCAGGCCTTTGGGGACTTCTCTCCCACAGATGTGCATAAACAGTATGCCATTGTGTTCCGGACACCCCCCTATCACAAGATGAAGATTGAGCGGCCTGTAACAGTGTTTCTGCAACTGAAACGCAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jeong Seon Kim et al.
Biochemical and biophysical research communications, 491(2), 337-342 (2017-07-25)
The NFκB family of transcription factors is crucial for innate or adaptive immunity, inflammation, and diseases including cancer. The two NFκB signaling pathways (canonical and non-canonical) differ from each other in extracellular signals, membrane receptors, signaling adaptors, and dimer subunits.
Shayna E Thomas-Jardin et al.
The Prostate, 80(2), 133-145 (2019-11-16)
The androgen receptor (AR) nuclear transcription factor is a therapeutic target for prostate cancer (PCa). Unfortunately, patients can develop resistance to AR-targeted therapies and progress to lethal disease, underscoring the importance of understanding the molecular mechanisms that underlie treatment resistance.
Laura Mondragón et al.
Cancer cell, 36(3), 268-287 (2019-08-27)
GAPDH is emerging as a key player in T cell development and function. To investigate the role of GAPDH in T cells, we generated a transgenic mouse model overexpressing GAPDH in the T cell lineage. Aged mice developed a peripheral Tfh-like lymphoma that

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico