Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU065681

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP8A2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTCATGGAGCCTGGAGCTACAACCGGGTGACCAAGTGCATCTTGTACTGCTTCTATAAGAACGTGGTCCTGTATATTATTGAGCTTTGGTTCGCCTTTGTTAATGGATTTTCTGGGCAGATTTTATTTGAACGTTGGTGCATCGGCCTGTACAATGTGATTTTCACCGCTTTGCCGCCCTTCACTCTGGGAATCTTTGAGAGGTCTTGCACTCAGGAGAGCATGCTCAGGTTTCCCCAGCTCTACAAAATCACCCAGAATGGCGAAGGCTTCAACACAAAGGTTTTCTGGGGTCACTGCATCAACGCCTTGGTCCACTCCCTCATCCTCTTCTGGTTTCCCATGAAAGCTCTGGAGCATGATACTGTGTTGACAAGTGGTCATGCTACCGACTATTTATTTGTTGGAAATATTGTTTACACATATGTTGTTGTTACTGTTTGTCTGAAAGCTGGTTTGGAGACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

A Dorronsoro et al.
Cell death & disease, 4, e972-e972 (2013-12-21)
The zinc-finger protein A20 is a key player in the negative feedback regulation of the nuclear factor kappa-light-chain-enhancer of activated B-cell (NF-κB) pathway in response to multiple stimuli. Tumor necrosis factor alpha (TNFα), a cytokine with pleiotropic effects on cellular
Kerstin Boengler et al.
Basic research in cardiology, 105(6), 771-785 (2010-10-21)
The signal transducer and activator of transcription 3 (STAT3) contributes to cardioprotection by ischemic pre- and postconditioning. Mitochondria are central elements of cardioprotective signaling, most likely by delaying mitochondrial permeability transition pore (MPTP) opening, and STAT3 has recently been identified
Antonio Pisano et al.
The Journal of biological chemistry, 290(22), 13958-13971 (2015-04-18)
The human inhibitor of Bruton's tyrosine kinase isoform α (IBtkα) is a BTB protein encoded by the IBTK gene, which maps to chromosomal locus 6q14.1, a mutational hot spot in lymphoproliferative disorders. Here, we demonstrate that IBtkα forms a CRL3(IBTK)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico