Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU063201

Sigma-Aldrich

MISSION® esiRNA

targeting human TACC3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAACTGGGGAAGATCATGGACAGGTTCGAAGAGGTTGTGTACCAGGCCATGGAGGAAGTTCAGAAGCAGAAGGAACTTTCCAAAGCTGAAATCCAGAAAGTTCTAAAAGAAAAAGACCAACTTACCACAGATCTGAACTCCATGGAGAAGTCCTTCTCCGACCTCTTCAAGCGTTTTGAGAAACAGAAAGAGGTGATCGAGGGCTACCGCAAGAACGAAGAGTCACTGAAGAAGTGCGTGGAGGATTACCTGGCAAGGATCACCCAGGAGGGCCAGAGGTACCAAGCCCTGAAGGCCCACGCGGAGGAGAAGCTGCAGCTGGCAAACGAGGAGATCGCCCAGGTCCGGAGCAAGGCCCAGGCGGAAGCGTTGGCCCTCCAGGCCAGCCTGAGGAAGGAGCAGATGCGCATCCAGTCGCTGGAGAAGACAGTGGAGCAGAAGACTAAAGAGAACGAGGAGCTGACCAGGATCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Congran Zhao et al.
Oncology letters, 15(5), 6881-6886 (2018-05-05)
TACC3, a member of the transforming acidic coiled-coil protein (TACC) family, is a multifunctional protein that is involved in various biological functions, including proliferation and differentiation of tumor cells, cancer progression and metastasis. The aims of the present study were
Feng Guo et al.
Oncology research, 26(2), 183-189 (2017-01-22)
Transforming acidic coiled-coil protein 3 (TACC3) is a member of the TACC family and plays an important role in regulating cell mitosis, transcription, and tumorigenesis. However, the expression pattern and roles of TACC3 in renal cell carcinoma (RCC) remain unclear.
Colleen Furey et al.
Cell reports, 30(1), 269-283 (2020-01-09)
End-binding proteins (EBs) are widely viewed as master regulators of microtubule dynamics and function. Here, we show that while EB1 mediates the dynamic microtubule capture of herpes simplex virus type 1 (HSV-1) in fibroblasts, in neuronal cells, infection occurs independently

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico