Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU051271

Sigma-Aldrich

MISSION® esiRNA

targeting human PDGFRB

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGACACTGCACGAGAAGAAAGGGGACGTTGCACTGCCTGTCCCCTATGATCACCAACGTGGCTTTTCTGGTATCTTTGAGGACAGAAGCTACATCTGCAAAACCACCATTGGGGACAGGGAGGTGGATTCTGATGCCTACTATGTCTACAGACTCCAGGTGTCATCCATCAACGTCTCTGTGAACGCAGTGCAGACTGTGGTCCGCCAGGGTGAGAACATCACCCTCATGTGCATTGTGATCGGGAATGAGGTGGTCAACTTCGAGTGGACATACCCCCGCAAAGAAAGTGGGCGGCTGGTGGAGCCGGTGACTGACTTCCTCTTGGATATGCCTTACCACATCCGCTCCATCCTGCACATCCCCAGTGCCGAGTTAGAAGACTCGGGGACCTACACCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bhanupriya Madarampalli et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(6), 1516-1524 (2019-03-17)
Cadherins are homophilic cell-to-cell adhesion molecules that help cells respond to environmental changes. Newly formed cadherin junctions are associated with increased cell phosphorylation, but the pathways driving this signaling response are largely unknown. Since cadherins have no intrinsic signaling activity
Zachary K Goldsmith et al.
Investigative ophthalmology & visual science, 59(11), 4486-4495 (2018-09-08)
Vitreous seeding remains the primary reason for treatment failure in eyes with retinoblastoma (Rb). Systemic and intra-arterial chemotherapy, each with its own inherent set of complications, have improved salvage rates for eyes with advanced disease, but the location and biology
N Shioda et al.
Molecular psychiatry, 22(8), 1205-1222 (2016-12-07)
Aberrant dopamine D
Yaoping Liu et al.
Genome research, 25(5), 679-689 (2015-04-11)
Candida albicans, the major invasive fungal pathogen of humans, can cause both debilitating mucosal infections and fatal invasive infections. Understanding the complex nature of the host-pathogen interaction in each of these contexts is essential to developing desperately needed therapies to
Alessia Alunno et al.
Journal of cellular and molecular medicine, 19(7), 1689-1696 (2015-03-11)
It has been recently reported that telocytes, a stromal (interstitial) cell subset involved in the control of local tissue homeostasis, are hampered in the target organs of inflammatory/autoimmune disorders. Since no data concerning telocytes in minor salivary glands (MSGs) are

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico