Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU047831

Sigma-Aldrich

MISSION® esiRNA

targeting human DDR2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCCCTAATTCTTCCTCCAGCGATGTACGCACTGTCAGTTACACCAATCTGAAGTTTATGGCTACCCAAATTGCCTCTGGCATGAAGTACCTTTCCTCTCTTAATTTTGTTCACCGAGATCTGGCCACACGAAACTGTTTAGTGGGTAAGAACTACACAATCAAGATAGCTGACTTTGGAATGAGCAGGAACCTGTACAGTGGTGACTATTACCGGATCCAGGGCCGGGCAGTGCTCCCTATCCGCTGGATGTCTTGGGAGAGTATCTTGCTGGGCAAGTTCACTACAGCAAGTGATGTGTGGGCCTTTGGGGTTACTTTGTGGGAGACTTTCACCTTTTGTCAAGAACAGCCCTATTCCCAGCTGTCAGATGAACAGGTTATTGAGAATACTGGAGAGTTCTTCCGAGACCAAGGGAGGCAGACTTACCTCCCTCAACCAGCCATTTGTCCTGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Khairul Anam et al.
Stem cell research & therapy, 4(5), 112-112 (2014-01-11)
Knowing the repertoire of cell signaling receptors would provide pivotal insight into the developmental and regenerative capabilities of bone marrow cell (BMC)-derived hematopoietic stem/progenitor cells (HSPCs) and bone marrow mesenchymal stromal cells (BMMSCs). Murine HSPCs were enriched from fluorescence-activated cell
Shijing Jia et al.
American journal of respiratory cell and molecular biology, 59(3), 295-305 (2018-04-14)
Progressive fibrosis is a complication of many chronic diseases, and collectively, organ fibrosis is the leading cause of death in the United States. Fibrosis is characterized by accumulation of activated fibroblasts and excessive deposition of extracellular matrix proteins, especially type
Binhui Xie et al.
Journal of experimental & clinical cancer research : CR, 34, 101-101 (2015-09-13)
Several studies have found that DDR2 is up-regulated in many tumor types and facilitates tumor progression. However, the role of DDR2 in hepatocellular carcinoma (HCC) progression and its downstream signaling pathways remain unclear. DDR2 expression was assessed in several cell

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico