Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU046261

Sigma-Aldrich

MISSION® esiRNA

targeting human SETDB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGGCAGTGGTTGAGGAACTGGGTATCTCTATGGAGGAACTTCGGCATTTCATCGATGAGGAACTGGAGAAGATGGATTGTGTACAGCAACGCAAGAAGCAGCTAGCAGAGTTAGAGACATGGGTAATACAGAAAGAATCTGAGGTGGCTCACGTTGACCAACTCTTTGATGATGCATCCAGGGCAGTGACTAATTGTGAGTCTTTGGTGAAGGACTTCTACTCCAAGCTGGGACTACAATACCGGGACAGTAGCTCTGAGGACGAATCTTCCCGGCCTACAGAAATAATTGAGATTCCTGATGAAGATGATGATGTCCTCAGTATTGATTCAGGTGATGCTGGGAGCAGAACTCCAAAAGACCAGAAGCTCCGTGAAGCTATGGCTGCCTTAAGAAAGTCAGCTCAAGATGTTCAGAAGTTCATGGATGCTGTCAACAAGAAGAGCAGTTCCCAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yingjie Shao et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 27(2), 355-364 (2018-12-07)
Radiotherapy is one of the most important treatment methods of tumors. However, the application of radiotherapy in hepatocellular carcinoma (HCC) is limited due to the low tolerance of normal liver cells for radiation and inherent radiation resistance in HCC. With the
Sibel Özdaş
Turkish journal of biology = Turk biyoloji dergisi, 43(5), 281-292 (2019-11-27)
Head and neck cancer (HNC) is the sixth most common cancer worldwide and therefore presents a global public health problem. There are no standard algorithms for the diagnosis and follow-up of the disease, and no effective current treatment approaches exist.
Young Joon Song et al.
Molecules and cells, 38(4), 362-372 (2015-02-27)
Setdb1, an H3-K9 specific histone methyltransferase, is associated with transcriptional silencing of euchromatic genes through chromatin modification. Functions of Setdb1 during development have been extensively studied in embryonic and mesenchymal stem cells as well as neurogenic progenitor cells. But the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico