Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU044261

Sigma-Aldrich

MISSION® esiRNA

targeting human CNR1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTCTGAGGATGGGAAGGTACAGGTGACCCGGCCAGACCAAGCCCGCATGGACATTAGGTTAGCCAAGACCCTGGTCCTGATCCTGGTGGTGTTGATCATCTGCTGGGGCCCTCTGCTTGCAATCATGGTGTATGATGTCTTTGGGAAGATGAACAAGCTCATTAAGACGGTGTTTGCATTCTGCAGTATGCTCTGCCTGCTGAACTCCACCGTGAACCCCATCATCTATGCTCTGAGGAGTAAGGACCTGCGACACGCTTTCCGGAGCATGTTTCCCTCTTGTGAAGGCACTGCGCAGCCTCTGGATAACAGCATGGGGGACTCGGACTGCCTGCACAAACACGCAAACAATGCAGCCAGTGTTCACAGGGCCGCAGAAAGCTGCATCAAGAGCACGGTCAAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Le Yang et al.
Molecular therapy. Nucleic acids, 20, 725-738 (2020-05-15)
Nod-like receptor (NLR) family pyrin domain containing 3 (NLRP3) has been regarded as an important initiator or promoter in multiple inflammatory diseases. However, the relationship between cannabinoid receptor 1 (CB1) and macrophage NLRP3 inflammasome and the corresponding molecular mechanism in
Elena Ciaglia et al.
Oncotarget, 6(17), 15464-15481 (2015-05-27)
Herein we show that a majority of human brain tumor samples and cell lines over-expressed cannabinoid receptor CB1 as compared to normal human astrocytes (NHA), while uniformly expressed low levels of CB2. This finding prompted us to investigate the therapeutic
Chih-Yuan Lin et al.
Journal of molecular and cellular cardiology, 85, 249-261 (2015-06-21)
Cannabinoid receptor type 1 (CB1R) plays an important role in the development of myocardial hypertrophy and fibrosis-2 pathological features of uremic cardiomyopathy. However, it remains unknown whether CB1R is involved in the pathogenesis of uremic cardiomyopathy. Here, we aimed to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico