Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU042361

Sigma-Aldrich

MISSION® esiRNA

targeting human STC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCAGGGAAAAGCATTCGTCAAAGAGAGCTTAAAATGCATCGCCAACGGGGTCACCTCCAAGGTCTTCCTCGCCATTCGGAGGTGCTCCACTTTCCAAAGGATGATTGCTGAGGTGCAGGAAGAGTGCTACAGCAAGCTGAATGTGTGCAGCATCGCCAAGCGGAACCCTGAAGCCATCACTGAGGTCGTCCAGCTGCCCAATCACTTCTCCAACAGATACTATAACAGACTTGTCCGAAGCCTGCTGGAATGTGATGAAGACACAGTCAGCACAATCAGAGACAGCCTGATGGAGAAAATTGGGCCTAACATGGCCAGCCTCTTCCACATCCTGCAGACAGACCACTGTGCCCAAACACACCCACGAGCTGACTTCAACAGGAGACGCACCAATGAGCCGCAGAAGCTGAAAGTCCTCCTCAGGAACCTCCGAGGTGAGGAGGACTCTCCCTCCCACATCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dong Dai et al.
Oncology reports, 35(1), 552-558 (2015-11-05)
The new anti-aging gene Klotho has been identified as a multi-functional humoral factor which influences multiple biological processes, including tumor progression. Although ample evidence indicates that Klotho plays important roles in cervical, lung and breast cancer, the role and mechanism
Wenru Su et al.
Journal of molecular cell biology, 9(4), 289-301 (2017-06-29)
Mesenchymal stem cells (MSCs) have been demonstrated to have promising therapeutic benefits for a variety of neurological diseases; however, the underlying mechanisms are poorly understood. Here, we showed that intravitreal infusion of MSCs promoted retinal ganglion cell (RGC) survival in
Huai-Bin Hu et al.
Nature communications, 12(1), 662-662 (2021-01-30)
Dynamic assembly and disassembly of primary cilia controls embryonic development and tissue homeostasis. Dysregulation of ciliogenesis causes human developmental diseases termed ciliopathies. Cell-intrinsic regulatory mechanisms of cilia disassembly have been well-studied. The extracellular cues controlling cilia disassembly remain elusive, however.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico