Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU041431

Sigma-Aldrich

MISSION® esiRNA

targeting human AQP4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCATGTGATTGACGTTGACCGGGGAGAGGAGAAGAAGGGGAAAGACCAATCTGGAGAGGTATTGTCTTCAGTATGACTAGAAGATCGCACTGAAAGCAGACAAGACTCCTTAGAACTGTCCTCAGATTTCCTTCCACCCATTAAGGAAACAGATTTGTTATAAATTAGAAATGTGCAGGTTTGTTGTTTCATGTCATATTACTCAGTCTAAACAATAAATATTTCATAATTTACAAAGGAGGAACGGAAGAAACCTATTGTGAATTCCAAATCTAAAAAAAGAAATATTTTTAAAATGTTCTTAAGCAAATATATACCTATTTTATCTAGTTACCTTTCATTAACAACCAATTTTAACCGTGTGTCAAGATTTGGTTAAGTCTTGCCTGACAGAACTCAAAGACACG

Ensembl | human accession no.

ENSG00000171885

NCBI accession no.

NM_001650

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AQP4(361) , AQP4(361)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chao Yang et al.
IUBMB life, 67(3), 182-190 (2015-04-11)
Emerging evidence indicates that the water channel protein aquaporin 4 (AQP4) plays an essential role in water homeostasis and is implicated in the pathogenesis of brain edema. This study aimed to understand the physiological role of AQP4 in hypoxia-ischemia-mediated cytotoxic
Letizia Granieri et al.
PloS one, 7(6), e38896-e38896 (2012-06-22)
Neuromyelitis optica (NMO) is a severely disabling autoimmune disorder of the central nervous system, which predominantly affects the optic nerves and spinal cord. In a majority of cases, NMO is associated with antibodies to aquaporin-4 (AQP4) (termed NMO-IgG). In this
Yusi Cheng et al.
Clinical and experimental pharmacology & physiology, 44(11), 1106-1115 (2017-07-09)
Aquaporin 4 (AQP4) is a type of water channel protein that maintains the water balance of cardiomyocytes. However, the physiological role of AQP4 in cardiovascular disease is poorly understood. We wanted to explore whether p66Shc and endoplasmic reticulum stress participates
Ya-Nan Li et al.
Medicine, 98(42), e17591-e17591 (2019-10-19)
Spinal cord ischemia-reperfusion injury (SCII) is a common complication of spinal surgery as well as thoracic and abdominal surgery. Acute cytotoxic edema is the key pathogenic alteration. Therefore, avoiding or decreasing cellular edema has become the major target for SCII
Dongfeng Niu et al.
PloS one, 7(7), e40770-e40770 (2012-07-19)
Aquaporin3 (AQP3) and Aquaporin4 (AQP4) play a major role in transcellular and transepithelial water movement as water channel membrane proteins. Little is known of their expression and significance in human thyroid tissues. Thus, we examined the expression of AQP3 and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico