Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU040501

Sigma-Aldrich

MISSION® esiRNA

targeting human UHRF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGGACCATGGGAATTTTTTCACATACACGGGTAGTGGTGGTCGAGATCTTTCCGGCAACAAGAGGACCGCGGAACAGTCTTGTGATCAGAAACTCACCAACACCAACAGGGCGCTGGCTCTCAACTGCTTTGCTCCCATCAATGACCAAGAAGGGGCCGAGGCCAAGGACTGGCGGTCGGGGAAGCCGGTCAGGGTGGTGCGCAATGTCAAGGGTGGCAAGAATAGCAAGTACGCCCCCGCTGAGGGCAACCGCTACGATGGCATCTACAAGGTTGTGAAATACTGGCCCGAGAAGGGGAAGTCCGGGTTTCTCGTGTGGCGCTACCTTCTGCGGAGGGACGATGATGAGCCTGGCCCTTGGACGAAGGAGGGGAAGGACCGGATCAAGAAGCTGGGGCTGACCATGCAGTATCCAGAAGGCTACCTGGAAGCCCTGGCCAACCGAGAGCGAGAGAAGGAGAA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mahmoud Alhosin et al.
Technology in cancer research & treatment, 19, 1533033820947489-1533033820947489 (2020-09-12)
Thymoquinone (TQ), a natural anticancer agent exerts cytotoxic effects on several tumors by targeting multiple pathways, including apoptosis. Difluoromethylornithine (DFMO), an irreversible inhibitor of the ornithine decarboxylase (ODC) enzyme, has shown promising inhibitory activities in many cancers including leukemia by
Jieying Chen et al.
Journal of cellular and molecular medicine, 22(5), 2856-2864 (2018-03-09)
WD repeat protein 79 (WDR79) is a member of the WD-repeat protein family characterized by the presence of a series of WD-repeat domains and is a scaffold protein that participates in telomerase assembly, Cajal body formation and DNA double strand
Ting-Ting Ge et al.
Journal of ovarian research, 9(1), 42-42 (2016-07-20)
Up-regulation of UHRF1 has been observed in a variety of cancers and appears to serve as an independent prognostic factor. To explore the effect of UHRF1 gene silencing on apoptosis and proliferation of cervical squamous cell carcinoma (CSCC) CaSki cells.
Guangyan Kan et al.
Oncotarget, 8(24), 39497-39511 (2017-05-04)
UHRF1 (ubiquitin-like with PHD and RING finger domains 1) is a critical regulator for DNA methylation, and its frequent overexpression in human cancers has been associated with tumor-promoting effects. However, whether the overexpressed UHRF1 contributes to the establishment and maintenance
Feng Yan et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(11), 8887-8893 (2015-06-14)
Ubiquitin-like with PHD and ring finger domains 1 (UHRF1), known as ICB90 or Np95, has been found to be overexpressed in numerous cancers. In this study, we evaluated the expression level of UHRF1 in ovarian cancer. UHRF1 levels in paired

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico