Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU034721

Sigma-Aldrich

MISSION® esiRNA

targeting human LGALS1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGACTCAATCATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGAAA

Ensembl | human accession no.

ENSG00000100097

NCBI accession no.

NM_002305

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LGALS1(3956) , LGALS1(3956)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Neus Martínez-Bosch et al.
Cancer research, 74(13), 3512-3524 (2014-05-09)
Despite some advances, pancreatic ductal adenocarcinoma (PDAC) remains generally refractory to current treatments. Desmoplastic stroma, a consistent hallmark of PDAC, has emerged as a major source of therapeutic resistance and thus potentially promising targets for improved treatment. The glycan-binding protein
P Zhang et al.
Cell death & disease, 5, e991-e991 (2014-01-11)
This study was performed to investigate the role of galectin-1 (Gal-1) in epithelial ovarian cancer (EOC) progression and chemoresistance. Tissue samples from patients with EOC were used to examine the correlation between Gal-1 expression and clinical stage of EOC. The
Noor Al-Obaidi et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 373-387 (2018-07-06)
Chronic exposure of tubular renal cells to high glucose contributes to tubulointerstitial changes in diabetic nephropathy. In the present study, we identified a new fibrosis gene called galectin-1 (Gal-1), which is highly expressed in tubular cells of kidneys of type
Jie Zhu et al.
American journal of translational research, 11(6), 3862-3878 (2019-07-18)
It has been reported that Galectin-1 (Gal-1) indicates bad prognosis of patients with ovarian cancer, and Gal-1 overexpression promotes metastasis of ovarian cancer cells. Nevertheless, the underlying mechanisms of the Gal-1-mediated enhancement of metastasis are still unclear. Furthermore, little is
Bing Yan et al.
International journal of biological sciences, 12(7), 850-860 (2016-06-18)
Lung cancer is the leading cause of cancer mortality around the world. Despite advances in the targeted therapy, patients with lung squamous cell carcinoma(SCC) still benefit few from it, and the search for potential effective therapies is imperative. Here, we
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico