Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU034191

Sigma-Aldrich

MISSION® esiRNA

targeting human S100A9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCTGGAACGCAACATAGAGACCATCATCAACACCTTCCACCAATACTCTGTGAAGCTGGGGCACCCAGACACCCTGAACCAGGGGGAATTCAAAGAGCTGGTGCGAAAAGATCTGCAAAATTTTCTCAAGAAGGAGAATAAGAATGAAAAGGTCATAGAACACATCATGGAGGACCTGGACACAAATGCAGACAAGCAGCTGAGCTTCGAGGAGTTCATCATGCTGATGGCGAGGCTAACCTGGGCCTCCCACGAGAAGATGCACGAGGGTGACGAGGGCCCTGGCCACCACCATAAGCCAGGCCTCGGGGAGGGCACCCCCTAAGACCACAGTGGCCAAGATCACAGTGGCCACGGCCACGGCCACAGTCATGGTGGCCACGGCCACAGCCACTAATCAGGAGGCCAGGCCACCCTGCCTCTACCCAACCAGGGCCCCGGGGCCTGTTATGTCAAACTGTCTTGGCTGTGG

Ensembl | human accession no.

ENSG00000163220

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... S100A9(6280) , S100A9(6280)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yiwen Zhou et al.
Frontiers in pharmacology, 12, 640521-640521 (2021-04-02)
Hepatic macrophages play a critical role in inflammation caused by alcohol feeding. During this process, variation of macrophage phenotypes triggers inflammatory responses in a variety of ways. Moreover, there is increasing evidence that Brain and Muscle Arnt-Like Protein-1 (Bmal1) is
Liang Peng et al.
Frontiers in cellular and infection microbiology, 10, 47-47 (2020-03-03)
Bacterial infection remains one of the leading causes of death worldwide due to the continuous rise of multiple antibiotic-resistant bacteria. Focusing solely on bacteria as the drug targets is a major limitation inherent in the conventional antibiotic therapy. Recently, host-directed
Ping Wu et al.
Oncology research, 25(9), 1479-1488 (2017-03-10)
Hypopharyngeal cancer (HPC) frequently presents at an advanced stage and displays early submucosal spread, resulting in a poor prognosis. It is among the worst of all cancers in the head and neck subsites. Therefore, detection of HPC at an earlier
Hirokazu Ohata et al.
Cell reports, 28(5), 1282-1295 (2019-08-01)
Cancer stem cells (CSCs) are associated with the refractory nature of cancer, and elucidating the targetable pathways for CSCs is crucial for devising innovative antitumor therapies. We find that the proliferation of CSC-enriched colon spheroids from clinical specimen is dependent
Shin-Hee Heo et al.
Cancer letters, 362(1), 139-148 (2015-04-02)
All-trans retinoic acid (ATRA), the most biologically active metabolite of vitamin A, has been extensively studied for the prevention and treatment of cancer; however, the underlying mechanism of its anti-cancer potential is still unclear. Here we found that ATRA induces
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico