Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU033391

Sigma-Aldrich

MISSION® esiRNA

targeting human MGMT

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGCTGAATGCCTATTTCCACCAGCCCGAGGCTATCGAAGAGTTCCCCGTGCCGGCTCTTCACCATCCCGTTTTCCAGCAAGAGTCGTTCACCAGACAGGTGTTATGGAAGCTGCTGAAGGTTGTGAAATTCGGAGAAGTGATTTCTTACCAGCAATTAGCAGCCCTGGCAGGCAACCCCAAAGCCGCGCGAGCAGTGGGAGGAGCAATGAGAGGCAATCCTGTCCCCATCCTCATCCCGTGCCACAGAGTGGTCTGCAGCAGCGGAGCCGTGGGCAACTACTCCGGAGGACTGGCCGTGAAGGAATGGCTTCTGGCCCATGAAGGCCACCGGTTGGGGAAGCCAGGCTTGGGAGGGAGCTCAGGTCTGGCAGGGGCCTGGCTCAAGGGAGCGGGAGCTACCTCGGGCTCCCCGCCTGCTGGCCGAAACTGAGTATGTGCAGTAGGATGGATGTTTGAGCGACACACACGTGTA

Ensembl | human accession no.

ENSG00000170430

NCBI accession no.

NM_002412

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MGMT(4255) , MGMT(4255)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Thatchawan Thanasupawat et al.
Molecular oncology, 11(8), 1078-1098 (2017-05-14)
The multikinase inhibitor and FDA-approved drug dovitinib (Dov) crosses the blood-brain barrier and was recently used as single drug application in clinical trials for GB patients with recurrent disease. The Dov-mediated molecular mechanisms in GB cells are unknown. We used
Jin Cheng et al.
Toxicology, 389, 67-73 (2017-07-20)
N-methyl-2,2-di(chloroethyl)amine (HN2) is a kind of bifunctional alkyltating agent, which can react with nucleophilic groups in DNA and/or protein to form HN2-bridged crosslinking of target molecules, such as DNA-protein crosslinkings (DPC). O
Xinwei Li et al.
Pathology oncology research : POR, 26(2), 707-714 (2019-02-04)
Primary central nervous system lymphoma (PCNSL) is an aggressive and rare subtype of non-Hodgkin lymphoma, arising exclusively in the CNS with a poor prognosis. Previous evidence has proved that MGMT was a promising target involving in TMZ resistance of PCNSL.
Lucio Tentori et al.
BMC cancer, 14, 151-151 (2014-03-07)
Chemoresistance of glioblastoma multiforme (GBM) has been attributed to the presence within the tumor of cancer stem cells (GSCs). The standard therapy for GBM consists of surgery followed by radiotherapy and the chemotherapeutic agent temozolomide (TMZ). However, TMZ efficacy is
Boswellic acid has anti-inflammatory effects and enhances the anticancer activities of Temozolomide and Afatinib, an irreversible ErbB family blocker, in human glioblastoma cells.
Manlio Barbarisi et al.
Phytotherapy research : PTR, 33(6), 1670-1682 (2019-03-30)
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico