Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU033081

Sigma-Aldrich

MISSION® esiRNA

targeting human ACE2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCAAACGGTTGAACACAATTCTAAATACAATGAGCACCATCTACAGTACTGGAAAAGTTTGTAACCCAGATAATCCACAAGAATGCTTATTACTTGAACCAGGTTTGAATGAAATAATGGCAAACAGTTTAGACTACAATGAGAGGCTCTGGGCTTGGGAAAGCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCATTATATGAAGAGTATGTGGTCTTGAAAAATGAGATGGCAAGAGCAAATCATTATGAGGACTATGGGGATTATTGGAGAGGAGACTATGAAGTAAATGGGGTAGATGGCTATGACTACAGCCGCGGCCAGTTGATTGAAGATGTGGAACATACCTTTGAAGAGATTAAACCATTATATGAACATCTTCATGCCTATGTGAGGGCAAAGTTGATGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Miki Yamaguchi et al.
Biochemical and biophysical research communications, 487(3), 613-618 (2017-04-24)
EGFR-mutant lung adenocarcinomas contain a subpopulation of cells that have undergone epithelial-to-mesenchymal transition and can grow independently of EGFR. To kill these cancer cells, we need a novel therapeutic approach other than EGFR inhibitors. If a molecule is specifically expressed
Yingchuan Li et al.
Scientific reports, 5, 8209-8209 (2015-02-04)
ACE2 and Ang-(1-7) have important roles in preventing acute lung injury. However, it is not clear whether upregulation of the ACE2/Ang-(1-7)/Mas axis prevents LPS-induced injury in pulmonary microvascular endothelial cells (PMVECs) by inhibiting the MAPKs/NF-κB pathways. Primary cultured rat PMVECs
Xi Cao et al.
Diabetes/metabolism research and reviews, 35(4), e3123-e3123 (2019-01-04)
Previous works indicated that the stress on the endoplasmic reticulum (ER) affected nonalcoholic fatty liver disease (NAFLD). However, there is no clear evident on the effect of the regulation of ER stress by angiotensin-converting enzyme 2 (ACE2) on the prevention

Protocolos

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico