Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU033071

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTTTCAGCTTCTCCGAGGTCTGGACTTTCTTCATTCACACCGAGTAGTGCATCGCGATCTAAAACCACAGAACATTCTGGTGACCAGCAGCGGACAAATAAAACTCGCTGACTTCGGCCTTGCCCGCATCTATAGTTTCCAGATGGCTCTAACCTCAGTGGTCGTCACGCTGTGGTACAGAGCACCCGAAGTCTTGCTCCAGTCCAGCTACGCCACCCCCGTGGATCTCTGGAGTGTTGGCTGCATATTTGCAGAAATGTTTCGTAGAAAGCCTCTTTTTCGTGGAAGTTCAGATGTTGATCAACTAGGAAAAATCTTGGACGTGATTGGACTCCCAGGAGAAGAAGACTGGCCTAGAGATGTTGCCCTTCCCAGGCAGGCTTTTCATTCAAAATCTGCCCAACCAATTGAG

Ensembl | human accession no.

ENSG00000105810

NCBI accession no.

NM_001259

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CDK6(1021) , CDK6(1021)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Míriam Tarrado-Castellarnau et al.
Molecular systems biology, 13(10), 940-940 (2017-10-06)
Cyclin-dependent kinases (CDK) are rational cancer therapeutic targets fraught with the development of acquired resistance by tumor cells. Through metabolic and transcriptomic analyses, we show that the inhibition of CDK4/6 leads to a metabolic reprogramming associated with gene networks orchestrated
Lihua Guo et al.
Journal of B.U.ON. : official journal of the Balkan Union of Oncology, 23(3), 787-794 (2018-07-14)
Clear cell renal cell carcinoma (ccRCC) accounts for 70-80% of renal cell carcinomas. Various microRNAs (miRs) have been reported to affect the tumorigenesis of ccRCC. However, the role of miR-384 in ccRCC is still unknown. Thus, the purpose of this
Xuefeng Pan et al.
Molecular therapy. Nucleic acids, 22, 38-49 (2020-09-11)
Emerging studies indicate that long noncoding RNAs (lncRNAs) play crucial roles in ovarian cancer (OC). By analyzing high-throughput data, we found that SNHG17 was highly expressed in multiple OC cohorts. However, its functions in OC were not explored. In this
Liam Cornell et al.
Cell reports, 26(10), 2667-2680 (2019-03-07)
CDK4/6 inhibition is now part of the standard armamentarium for patients with estrogen receptor-positive (ER+) breast cancer, so that defining mechanisms of resistance is a pressing issue. Here, we identify increased CDK6 expression as a key determinant of acquired resistance
Tongzheng Liu et al.
Nature communications, 8, 13923-13923 (2017-01-10)
Tumour metastasis, the spread of cancer cells from the original tumour site followed by growth of secondary tumours at distant organs, is the primary cause of cancer-related deaths and remains poorly understood. Here we demonstrate that inhibition of CDK4/6 blocks
Ver todos los artículos relacionados

Protocolos

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico