Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU026341

Sigma-Aldrich

MISSION® esiRNA

targeting human GLI1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCCAATCACAAGTCAGGTTCCTATCCCACCCCTTCACCATGCCATGAAAATTTTGTAGTGGGGGCAAATAGGGCTTCACATAGGGCAGCAGCACCACCTCGACTTCTGCCCCCATTGCCCACTTGCTATGGGCCTCTCAAAGTGGGAGGCACAAACCCCAGCTGTGGTCATCCTGAGGTGGGCAGGCTAGGAGGGGGTCCTGCCTTGTACCCTCCTCCCGAAGGACAGGTATGTAACCCCCTGGACTCTCTTGATCTTGACAACACTCAGCTGGACTTTGTGGCTATTCTGGATGAGCCCCAGGGGCTGAGTCCTCCTCCTTCCCATGATCAGCGGGGCAGCTCTGGACATACCCCACCTCCCTCTGGGCCCCCCAACATGGCTGTGGGCAACATGAGTGTCTTACTGAGATCCCTACCTGGGGAAACAGAATTCCTCAACTCTAGTGCCTAAAGAGTAGGGAATCTCATCCATCACAGATCGCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yang Chong et al.
Journal of experimental & clinical cancer research : CR, 35(1), 175-175 (2016-11-12)
Gastric cancer (GC) is characterized by the excessive deposition of extracellular matrix, which is thought to contribute to this tumor's malignant behavior. Epithelial-mesenchymal transition (EMT) is regarded as a crucial contributing factor to cancer progression. Galectin-1 (Gal-1), a β-galactoside-binding protein
Xinyi Cai et al.
OncoTargets and therapy, 8, 877-883 (2015-05-07)
The Hedgehog (Hh) signaling pathway not only plays important roles in embryogenesis and adult tissue homeostasis, but also in tumorigenesis. Aberrant Hh pathway activation has been reported in a variety of malignant tumors including colon carcinoma. Here, we sought to
Hyungsin Kim et al.
Cancers, 11(9) (2019-09-08)
Despite the presence of aggressive treatment strategies, glioblastoma remains intractable, warranting a novel therapeutic modality. An oral antipsychotic agent, penflurido (PFD), used for schizophrenia treatment, has shown an antitumor effect on various types of cancer cells. As glioma sphere-forming cells
Yumei Diao et al.
Molecular oncology, 12(10), 1718-1734 (2018-08-12)
Hedgehog (HH) signaling is involved in many physiological processes, and pathway deregulation can result in a wide range of malignancies. Glioma-associated oncogene 1 (GLI1) is a transcription factor and a terminal effector of the HH cascade. Despite its crucial role
Guodong Zhang et al.
Experimental and therapeutic medicine, 19(4), 2913-2922 (2020-04-08)
The efficacy of ginsenoside Rh2 (Rh2) in cancer therapy has been reported; however, its function in lung cancer remains unknown. To analyze the role of Rh2 in the inhibition of lung cancer cell proliferation in the present study, protein expression

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico