Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU018231

Sigma-Aldrich

MISSION® esiRNA

targeting human SP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGCTCCCAACTTACAGAACCAGCAAGTTCTGACAGGACTACCTGGAGTGATGCCTAATATTCAGTATCAAGTAATCCCACAGTTCCAGACCGTTGATGGGCAACAGCTGCAGTTTGCTGCCACTGGGGCCCAAGTGCAGCAGGATGGTTCTGGTCAAATACAGATCATACCAGGTGCAAACCAACAGATTATCACAAATCGAGGAAGTGGAGGCAACATCATTGCTGCTATGCCAAACCTACTCCAGCAGGCTGTCCCCCTCCAAGGCCTGGCTAATAATGTACTCTCAGGACAGACTCAGTATGTGACCAATGTACCAGTGGCCCTGAATGGGAACATCACCTTGCTACCTGTCAACAGCGTTTCTGCAGCTACCTTGACTCCCAGCTCTCAGGCAGTCACGATCAGCAGCTCTGGGTCCCAGGAGAGTGGCTCACAGCCTGTCACCTCAGGGACTACCATCAGTTCTGCCAGCTTGGTATCATCACAAGCCAGTTCCAGCT

Ensembl | human accession no.

ENSG00000185591

NCBI accession no.

NM_138473

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SP1(6667) , SP1(6667)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Im-Kyung Kim et al.
Scientific reports, 9(1), 5933-5933 (2019-04-13)
Specific protein 1 (SP1) is associated with aggressive behavior, invasive clinical phenotype and poor clinical outcomes in various cancers. We studied whether SP1 exerts its effect on invasiveness and promotion of the epithelial-mesenchymal transition (EMT) by regulating lysyl oxidase-like 2
Qiang Cai et al.
American journal of translational research, 8(10), 4068-4081 (2016-11-11)
Gallbladder cancer (GBC) is one of the most lethal cancers with poor prognosis. In this study, we report that the long non-coding RNA LINC00152 is significantly upregulated in GBC tissues and cell lines. The high LINC00152 levels correlated positively with
Moon-Chang Choi et al.
International journal of molecular sciences, 19(5) (2018-05-12)
Osteoarthritis (OA) is the most common and increasing joint disease worldwide. Current treatment for OA is limited to control of symptoms. The purpose of this study was to determine the effect of specificity protein 1 (SP1) inhibitor Mithramycin A (MitA)
Yuehua Zhao et al.
Molecular medicine reports, 16(2), 2191-2198 (2017-06-20)
Research into the expression and function of microRNAs (miRNAs/miR) in human cancer has provided novel insights into the molecular mechanisms underlying carcinogenesis and cancer progression. Aberrant miRNA expression has been reported in retinoblastoma (RB) and several other types of human
Jingnan Liu et al.
Human molecular genetics, 25(4), 672-680 (2016-01-09)
Mutations in leucine-rich repeat kinase 2 (LRRK2) cause autosomal-dominant Parkinsonism with pleomorphic pathology including deposits of aggregated protein and neuronal degeneration. The pathogenesis of LRRK2-linked Parkinson's disease (PD) is not fully understood. Here, using co-immunoprecipitation, we found that LRRK2 interacted
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico