Saltar al contenido
Merck

EHU017401

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGGGATGGAACAGGACAGGAGGTGGTAGTGGATACCAGTTTGGAGAGCCCAGCTGGCCTGGCCATTGATTGGGTCACCAACAAACTGTACTGGACAGATGCAGGTACAGACCGGATTGAAGTAGCCAACACAGATGGCAGCATGAGAACAGTACTCATCTGGGAGAACCTTGATCGTCCTCGGGACATCGTGGTGGAACCCATGGGCGGGTACATGTATTGGACTGACTGGGGTGCGAGCCCCAAGATTGAACGAGCTGGCATGGATGCCTCAGGCCGCCAAGTCATTATCTCTTCTAATCTGACCTGGCCTAATGGGTTAGCTATTGATTATGGGTCCCAGCGTCTATACTGGGCTGACGCCGGCATGAAGACAATTGAATTTGCTGGACTGGATGGCAGTAAGAGGAAGGTGCTGATTGGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qian Zhang et al.
Theranostics, 10(2), 602-614 (2020-01-07)
The mineral dust-induced gene (mdig) is overexpressed in a number of human cancers, suggesting critical roles of this gene played on the pathogenesis of cancers. Unlike several other JmjC-domain containing proteins that exhibit histone demethylase activity, it remains enigmatic whether
Xiaofen Zhou et al.
Biochemical and biophysical research communications, 503(1), 257-263 (2018-06-11)
Dysregulation of cell proliferation and death is considered the foundation of the malignant biological characteristics of cancer. In this study, we conducted a comprehensive analysis of a massively parallel whole transcriptome resequencing of paired papillary thyroid cancer and normal thyroid
Kai Wu et al.
Scientific reports, 6, 36305-36305 (2016-11-12)
Several epidemiological studies suggested an increased incidence rate of multiple myeloma (MM) among first responders and other individuals who exposed to World Trade Center (WTC) dust. In this report, we provided evidence showing that WTC dust is potent in inducing

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico