Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

Otros documentos

EHU014831

Sigma-Aldrich

MISSION® esiRNA

targeting human BUB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACCCAGTTGATGGAAAGACTAAAGCCATCTATGCAGCACATGTTTATGAAGTTCTATTCTGCCCACTTATTCCAGAATGGCAGTGTATTAGTAGGAGAGCTCTACAGCTATGGAACATTATTAAATGCCATTAACCTCTATAAAAATACCCCTGAAAAAGTGATGCCTCAAGGTCTTGTCATCTCTTTTGCTATGAGAATGCTTTACATGATTGAGCAAGTGCATGACTGTGAAATCATTCATGGAGACATTAAACCAGACAATTTCATACTTGGAAACGGGCAAGTATTTTTGGAACAGGATGATGAAGATGATTTATCTGCTGGCTTGGCACTGATTGACCTGGGTCAGAGTATAGATATGAAACTTTTTCCAAAAGGAACTATATTCACAGCAAAGTGTGAAACATCTGGTTTTCAGTGTGTTGAGATGCTCAGCAACAAACCATGGAACTACCAGATCGATTACTTTGGGGTTGCTGCAACAGTATATTGCATGCTCTTTGGCAC

Ensembl | human accession no.

ENSG00000169679

NCBI accession no.

NM_004336

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BUB1(699) , BUB1(699)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mathijs Vleugel et al.
Journal of cell science, 128(16), 2975-2982 (2015-07-08)
Mitotic chromosome segregation is initiated by the anaphase promoting complex/cyclosome (APC/C) and its co-activator CDC20 (forming APC/C(CDC20)). APC/C(CDC20) is inhibited by the spindle assembly checkpoint (SAC) when chromosomes have not attached to spindle microtubules. Unattached kinetochores catalyze the formation of
Yutaka Matsubara et al.
Shock (Augusta, Ga.), 51(3), 364-371 (2018-04-03)
Severe sepsis is critical to health and can result in acute renal failure (ARF). Tissue factor (TF) and thrombomodulin (TM) play key roles in vascular endothelial functions by helping maintain microcirculation in the kidney. Budding uninhibited by benzimidazole-1 (Bub1) plays
Katharina Overlack et al.
Current biology : CB, 27(19), 2915-2927 (2017-09-26)
The spindle assembly checkpoint (SAC) prevents premature sister chromatid separation during mitosis. Phosphorylation of unattached kinetochores by the Mps1 kinase promotes recruitment of SAC machinery that catalyzes assembly of the SAC effector mitotic checkpoint complex (MCC). The SAC protein Bub3
Grégory Eot-Houllier et al.
Nature communications, 9(1), 1888-1888 (2018-05-16)
Sustained spindle tension applied to sister centromeres during mitosis eventually leads to uncoordinated loss of sister chromatid cohesion, a phenomenon known as "cohesion fatigue." We report that Aurora A-dependent phosphorylation of serine 7 of the centromere histone variant CENP-A (p-CENP-AS7)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico