Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU012921

Sigma-Aldrich

MISSION® esiRNA

targeting human ABCG2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTATCCGTGGTGTGTCTGGAGGAGAAAGAAAAAGGACTAGTATAGGAATGGAGCTTATCACTGATCCTTCCATCTTGTTCTTGGATGAGCCTACAACTGGCTTAGACTCAAGCACAGCAAATGCTGTCCTTTTGCTCCTGAAAAGGATGTCTAAGCAGGGACGAACAATCATCTTCTCCATTCATCAGCCTCGATATTCCATCTTCAAGTTGTTTGATAGCCTCACCTTATTGGCCTCAGGAAGACTTATGTTCCACGGGCCTGCTCAGGAGGCCTTGGGATACTTTGAATCAGCTGGTTATCACTGTGAGGCCTATAATAACCCTGCAGACTTCTTCTTGGACATCATTAATGGAGATTCCACTGCTGTGGCATTAAACAGAGAAGAAGACTTTAAAGCCACAGAGATCATAGAGCCTTCCAAGCAGG

Ensembl | human accession no.

ENSG00000118777

NCBI accession no.

NM_004827

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ABCG2(9429) , ABCG2(9429)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Simran Kaur et al.
Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 87, 104662-104662 (2020-12-06)
The lengthy TB chemotherapeutic regimen, resulting in the emergence of drug resistance strains, poses a serious problem in the cure of the disease. Further, one-quarter of the world's population is infected with dormant M.tb, which creates a lifetime risk of
Hisakazu Komori et al.
Biochimica et biophysica acta, 1860(5), 973-980 (2018-01-11)
Hyperuricemia has been recognized as an independent risk factor for cardiovascular disease. Urate stimulates NADPH oxidase and induces production of reactive oxygen species (ROS); consequently, intracellular urate accumulation can induce oxidative stress leading to endothelial dysfunction. Here, we studied the
Long Chen et al.
Oncotarget, 8(26), 43237-43247 (2017-06-08)
We analyzed the role of ABCG2, a drug transporter, in determining the sensitivity of glioma stem cells (GSCs) to demethoxycurcumin (DMC). We first demonstrated that ABCG2 is more highly expressed in GSCs than primary astrocytes. Modulation of ABCG2 levels in
Junqing Wang et al.
Oncotarget, 8(3), 5256-5267 (2016-12-29)
ABCG2, member of ATP-binding cassette (ABC) transporter family, is known as crucial regulator related to multi-drug resistance in human tumors and has recently been putatively studied as human carcinoma cell biomarker. While, effects of ABCG2 on human gastric cancer (GC)
Kang Xu et al.
Phytotherapy research : PTR, 33(6), 1717-1725 (2019-04-25)
Inflammation is considered to be one of the initial critical factors in the occurrence of calcific heart valve disease. This study was to prove Nobiletin (NBT) inhibits inflammation-caused calcification of human valve interstitial cells (hVICs) and to elucidate the involved
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico