Saltar al contenido
Merck

EHU011171

Sigma-Aldrich

MISSION® esiRNA

targeting human CSNK2A2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCACCAACAGAAAAAGCTGCGACTGATAGATTGGGGTCTGGCAGAATTCTATCATCCTGCTCAGGAGTACAATGTTCGTGTAGCCTCAAGGTACTTCAAGGGACCAGAGCTCCTCGTGGACTATCAGATGTATGATTATAGCTTGGACATGTGGAGTTTGGGCTGTATGTTAGCAAGCATGATCTTTCGAAGGGAACCATTCTTCCATGGACAGGACAACTATGACCAGCTTGTTCGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jintaek Im et al.
Apoptosis : an international journal on programmed cell death, 24(5-6), 499-510 (2019-03-10)
Idiopathic pulmonary fibrosis (IPF) is a deadly and progressive fibrotic lung disease, but the precise etiology remains elusive. IPF is characterized by the presence of apoptosis-resistant (myo)fibroblasts that relentlessly produce a collagen-rich extracellular matrix (ECM). Recent studies showed that an
Hai Lu et al.
Neoplasia (New York, N.Y.), 16(10), 789-800 (2014-11-08)
Cancer stem cells (CSC) and genes have been linked to cancer development and therapeutic resistance, but the signaling mechanisms regulating CSC genes and phenotype are incompletely understood. CK2 has emerged as a key signal serine/threonine kinase that modulates diverse signal
Sung Won Lee et al.
PloS one, 11(11), e0166450-e0166450 (2016-11-17)
Although alpha (α)B-crystallin is expressed in articular chondrocytes, little is known about its role in these cells. Protein kinase casein kinase 2 (CK2) inhibition induces articular chondrocyte death. The present study examines whether αB-crystallin exerts anti-apoptotic activity in articular chondrocytes.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico