Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU005381

Sigma-Aldrich

MISSION® esiRNA

targeting human MDM4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGGACGTCAGAGCTTCTCCGTGAAAGACCCAAGCCCTCTCTATGATATGCTAAGAAAGAATCTTGTCACTTTAGCCACTGCTACTACAGATGCTGCTCAGACTCTCGCTCTCGCACAGGATCACAGTATGGATATTCCAAGTCAAGACCAACTGAAGCAAAGTGCAGAGGAAAGTTCCACTTCCAGAAAAAGAACTACAGAAGACGATATCCCCACACTGCCTACCTCAGAGCATAAATGCATACATTCTAGAGAAGATGAAGACTTAATTGAAAATTTAGCCCAAGATGAAACATCTAGGCTGGACCTTGGATTTGAGGAGTGGGATGTAGCTGGCCTGCCTTGGTGGTTTTTAGGAAACTTGAGAAGCAACTATACACCTAGAAGTAATGGCTCAACTGATTTACAGACAAATCAGGATGTGGGTACTGCCATT

Ensembl | human accession no.

ENSG00000198625

NCBI accession no.

NM_002393

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MDM4(4194) , MDM4(4194)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kehua Jiang et al.
Molecular genetics & genomic medicine, 7(8), e833-e833 (2019-06-30)
MicroRNA-33a (miR-33a) plays the role of the tumor suppressor gene by regulating the expression level of downstream genes. However, the effects of miR-33a in renal cell cancer (RCC) remain unknown. Our study was designed to investigate the expression level and
Haishan Zhang et al.
Molecular immunology, 125, 9-14 (2020-07-04)
MiR-483-3p is involved in the pathogenesis of acute myocardial infarctions, but its association with myocardial ischemia reperfusion (IR) remains mostly unknown. In this study, an in vitro model of myocardial IR injury was established by putting H9c2 cells into hypoxia
Hong Yan et al.
American journal of cancer research, 9(2), 312-329 (2019-03-25)
Activated KRAS is frequently observed and paralleled by inactivating of tumor suppressors in lung cancer, while the mechanisms remained elusive. Here, our study revealed a microRNA was involved in KRAS overexpression, activation of KRAS signaling and its synergy with inactivating
Yan Li et al.
Journal of molecular histology, 46(4-5), 357-364 (2015-06-21)
Multidrug resistance-associated protein 1 (MRP1) belongs to ATP-binding cassette transporters family. The overexpression of MRP1 is predominantly related with the failure of chemo-radiotherapy in various tumors. However, its possible role in hypertrophic scar (HS) is hardly investigated. Here we showed

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico