Todas las fotos(1)

Key Documents

Certificado de origen (COO)/COA

Otros documentos

EHU003471

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human SRF

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Todas las fotos(1)

About This Item

UNSPSC Code:

41105324

NACRES:

NA.51

description

Quality Level

100

product line

MISSION^®

form

lyophilized powder

esiRNA cDNA target sequence

ACGACCTTCAGCAAGAGGAAGACGGGCATCATGAAGAAGGCCTATGAGCTGTCCACGCTGACAGGGACACAGGTGCTGTTGCTGGTGGCCAGTGAGACAGGCCATGTGTATACCTTTGCCACCCGAAAACTGCAGCCCATGATCACCAGTGAGACCGGCAAGGCACTGATTCAGACCTGCCTCAACTCGCCAGACTCTCCACCCCGTTCAGACCCCACAACAGACCAGAGAATGAGTGCCACTGGCTTTGAAGAGACAGATCTCACCTACCAGGTGTCGGAGTCTGACAGCAGTGGGGAGACCAAGGACACACTGAAGCCGGCGTTCACAGTCACCAACCTGCCGGGTACAACCTCCACCATCCAAACAGCACCTAGCACCTCTACCACCATGCAAGTCAGCAGCGGCCCCTCCTTTCCCATCACCAACTACCTGGCACC

Ensembl | human accession no.

ENSG00000112658

NCBI accession no.

NM_003131

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SRF(6722) , SRF(6722)

Categorías relacionadas

MISSION® esiRNA

General description

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Resveratrol Enhances Cardiomyocyte Differentiation of Human Induced Pluripotent Stem Cells through Inhibiting Canonical WNT Signal Pathway and Enhancing Serum Response Factor-miR-1 Axis.

Hui Liu et al.

Stem cells international, 2016, 2524092-2524092 (2016-01-23)

Resveratrol (trans-3,5,4'-trihydroxystilbene) (RSV) is a natural polyphenol with protective effects over cardiac tissues and can affect cell survival and differentiation in cardiac stem cells transplantation. However, whether this agent can affect cardiomyocytes (CMs) differentiation of induced pluripotent stem cells (iPSCs)

Testosterone Rescues the De-Differentiation of Smooth Muscle Cells Through Serum Response Factor/Myocardin.

Carolina Leimgruber et al.

Journal of cellular physiology, 232(10), 2806-2817 (2016-11-20)

Prostatic smooth muscle cells (pSMCs) differentiation is a key factor for prostatic homeostasis, with androgens exerting multiple effects on these cells. Here, we demonstrated that the myodifferentiator complex Srf/Myocd is up-regulated by testosterone in a dose-dependent manner in primary cultures

An intragenic SRF-dependent regulatory motif directs cardiac-specific microRNA-1-1/133a-2 expression.

Qi Li et al.

PloS one, 8(9), e75470-e75470 (2013-09-24)

Transcriptional regulation is essential for any gene expression including microRNA expression. MiR-1-1 and miR-133a-2 are essential microRNAs (miRs) involved in cardiac and skeletal muscle development and diseases. Early studies reveal two regulatory enhancers, an upstream and an intragenic, that direct

Methylmercury induces the expression of chemokine CCL4 via SRF activation in C17.2 mouse neural stem cells.

Min-Seok Kim et al.

Scientific reports, 9(1), 4631-4631 (2019-03-16)

Methylmercury is an environmental pollutant that causes specific and serious damage to the central nervous system. We have previously shown that C-C motif chemokine ligand 4 (CCL4) protects cultured neural cells from methylmercury toxicity and expression of CCL4 is specifically

Serum response factor is overexpressed in esophageal squamous cell carcinoma and promotes Eca-109 cell proliferation and invasion.

Xi He et al.

Oncology letters, 5(3), 819-824 (2013-02-22)

Recent studies indicate that serum response factor (SRF) is highly expressed in tumors such as hepatocellular, thyroid, esophageal and lung carcinoma. However, the expression and roles of SRF in esophageal squamous cell carcinoma (ESCC) are unclear. In this study, immunohistochemistry

Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico