Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU001001

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF1A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCAAGTGCCACAAAGGAACCTACTTGTACAATGACTGTCCAGGCCCGGGGCAGGATACGGACTGCAGGGAGTGTGAGAGCGGCTCCTTCACCGCTTCAGAAAACCACCTCAGACACTGCCTCAGCTGCTCCAAATGCCGAAAGGAAATGGGTCAGGTGGAGATCTCTTCTTGCACAGTGGACCGGGACACCGTGTGTGGCTGCAGGAAGAACCAGTACCGGCATTATTGGAGTGAAAACCTTTTCCAGTGCTTCAATTGCAGCCTCTGCCTCAATGGGACCGTGCACCTCTCCTGCCAGGAGAAACAGAACACCGTGTGCACCTGCCATGCAGGTTTCTTTCTAAGAGAAAACGAGTGTGTCTCCTGTAGTAACTGTAAGAAAAGCCTGGAGTGCACGAAGTTGTGCCTACCCCAGATTGAGAATGTTAAGGGCACTGAGGACTCAGGCACCACAGTGCTGTTGCCCCTGGTCATTTTCTTTGGTCTTTGCCTTTTATCCCTCCTCTTCATTGGTTTAATGTATCGCTACCAACGGTGGAAGTCCAAGCTCTACTCCATTGTTTGTGGGAAATCGACA

Ensembl | human accession no.

ENSG00000067182

NCBI accession no.

NM_001065

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TNFRSF1A(7132) , TNFRSF1A(7132)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hui Xu et al.
Toxicology letters, 280, 171-180 (2017-09-03)
Dysregulation of microRNAs (miRNAs) has been implicated in the pathogenesis of chronic obstructive pulmonary disease (COPD), which is largely attributable to cigarette smoke (CS). However, little is known about the effect of miRNAs on CS-induced mucus hypersecretion and the inflammatory
Yang Yu et al.
American journal of physiology. Heart and circulatory physiology, 313(4), H744-H756 (2017-07-16)
In systolic heart failure (HF), circulating proinflammatory cytokines upregulate inflammation and renin-angiotensin system (RAS) activity in cardiovascular regions of the brain, contributing to sympathetic excitation and cardiac dysfunction. Important among these is the subfornical organ (SFO), a forebrain circumventricular organ
Susana P Egusquiaguirre et al.
Neoplasia (New York, N.Y.), 20(5), 489-498 (2018-04-06)
The transcription factor STAT3 is activated inappropriately in 70% of breast cancers, most commonly in triple negative breast cancer (TNBC). Although the transcriptional function of STAT3 is essential for tumorigenesis, the key target genes regulated by STAT3 in driving tumor
Ruizhe Zhao et al.
Cell proliferation, 51(3), e12415-e12415 (2017-12-02)
Urinary tract infection, urinary frequency, urgency, urodynia and haemorrhage are common post-operative complications of thulium laser resection of the prostate (TmLRP). Our study mainly focuses on the role of finasteride in prostate wound healing through AR signalling. TmLRP beagles were
Xusheng Wang et al.
Nature communications, 8, 14091-14091 (2017-03-28)
Skin stem cells can regenerate epidermal appendages; however, hair follicles (HF) lost as a result of injury are barely regenerated. Here we show that macrophages in wounds activate HF stem cells, leading to telogen-anagen transition (TAT) around the wound and
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico