Skip to Content
Merck
All Photos(1)

Key Documents

EMU186411

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Myh9

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAGTCACCATGGCTCAGCAGGCTGCAGACAAGTACCTCTATGTGGATAAAAACTTCATCAATAACCCGCTGGCCCAAGCTGACTGGGCTGCCAAGAAGTTGGTATGGGTGCCTTCCAGCAAGAATGGCTTTGAACCAGCTAGCCTCAAGGAGGAGGTGGGAGAAGAGGCCATTGTAGAGCTGGTAGAGAATGGGAAGAAGGTGAAGGTGAACAAGGACGACATCCAGAAGATGAACCCACCCAAGTTCTCCAAGGTGGAGGACATGGCAGAGCTCACGTGCCTCAACGAAGCTTCGGTGCTGCACAACCTCAAGGAGCGATACTACTCAGGGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chii J Chan et al.
Biophysical journal, 108(8), 1856-1869 (2015-04-23)
The cellular cytoskeleton is crucial for many cellular functions such as cell motility and wound healing, as well as other processes that require shape change or force generation. Actin is one cytoskeleton component that regulates cell mechanics. Important properties driving
Bing Zhao et al.
Nature communications, 6, 7166-7166 (2015-05-15)
Lgr5+ stem cells are crucial to gut epithelium homeostasis, and therapies targeting these cells hold promise for treatment of gastrointestinal diseases. Here we report that the non-muscle-myosin-II (NMII) heavy chain Myh9 accumulates at epithelial injury sites in mice distal colon

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service