Skip to Content
Merck
All Photos(1)

Key Documents

EMU182841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd68

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTTGGGGCATATCTGTTTTGAATCCCAACAAAACCAAGGTCCAGGGAGGTTGTGACGGTACCCATCCCCACCTGTCTCTCTCATTTCCTTATGGACAGCTTACCTTTGGATTCAAACAGGACCTACATCAGAGCCCGAGTACAGTCTACCTGGACTACATGGCGGTGGAATACAATGTGTCCTTCCCACAGGCAGCACAGTGGACATTCATGGCGCAGAATTCATCTCTTCGAGAGCTCCAAGCTCCCTTGGGCCAAAGCTTCTGCTGTGGAAATGCAAGCATAGTTCTTTCTCCAGCTGTTCACCTTGACCTGCTCTCTCTAAGGCTACAGGCTGCTCAGCTGCCTGACAAGGGACACTTCGGGCCATGTTTCTCTTGCAACCGTGACCAGTCCCTCTTGCTGCCTCTCATCATTGGCCTGGTCCTCCTCGGCCTCCTCACCCTGGTGCTCATCGCCTTCTGCATCACCCGCAGACGACAATCAACCTACCAGCCCCTCTGAGCATC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Asif Manzoor Khan et al.
Neurobiology of aging, 36(6), 2164-2175 (2015-04-22)
The susceptibility of the aging brain to neurodegenerative disease may in part be attributed to cellular aging of the microglial cells that survey it. We investigated the effect of cellular aging induced by telomere shortening on microglia by the use
Bao-xiang Pei et al.
The Journal of thoracic and cardiovascular surgery, 148(4), 1208-1216 (2014-06-08)
Recent experimental evidence has indicated that interstitial tumor-associated macrophages (TAMs), tumor-derived macrophage colony-stimulating factor (also known as CSF-1), and interleukin-6 (IL-6) interact in the pathogenesis of malignant epithelial tumors, including lung cancer. The present study aimed to explore their relationship
Carlos Tarin et al.
Scientific reports, 5, 17135-17135 (2015-12-01)
CD163 is a membrane receptor expressed by macrophage lineage. Studies performed in atherosclerosis have shown that CD163 expression is increased at inflammatory sites, pointing at the presence of intraplaque hemorrhagic sites or asymptomatic plaques. Hence, imaging of CD163 expressing macrophages
Andrea Doni et al.
The Journal of experimental medicine, 212(6), 905-925 (2015-05-13)
Pentraxin 3 (PTX3) is a fluid-phase pattern recognition molecule and a key component of the humoral arm of innate immunity. In four different models of tissue damage in mice, PTX3 deficiency was associated with increased fibrin deposition and persistence, and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service