Skip to Content
Merck
All Photos(1)

Key Documents

EHU106681

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP6AP2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCAGTTCACTCCCCCTCAATTCTCTGAGTAGGAACAATGAAGTTGACCTGCTCTTTCTTTCTGAACTGCAAGTGCTACATGATATTTCAAGCTTGCTGTCTCGTCATAAGCATCTAGCCAAGGATCATTCTCCTGATTTATATTCACTGGAGCTGGCAGGTTTGGATGAAATTGGGAAGCGTTATGGGGAAGACTCTGAACAATTCAGAGATGCTTCTAAGATCCTTGTTGACGCTCTGCAAAAGTTTGCAGATGACATGTACAGTCTTTATGGTGGGAATGCAGTGGTAGAGTTAGTCACTGTCAAGTCATTTGACACCTCCCTCATTAGGAAGACAAGGACTATCCTTGAGGCAAAACAAGCGAAGAACCCAGCAAGTCCCTATAACCTTGCATATAAGTATAATTTTGAATATTCCGTGGTTTTCAACATGGTACTTTGGATAATGATCGCCTTGGCCTTGGCTGTGATTATCACCTCTTACAATATTTGGAACATGGATCCTGGAT

Ensembl | human accession no.

ENSG00000182220

NCBI accession no.

NM_005765

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ATP6AP2(10159) , ATP6AP2(10159)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ting-Ting Chang et al.
European journal of clinical investigation, 46(6), 544-554 (2016-04-12)
Endothelial progenitor cell (EPC) functions are impaired in the presence of diabetes mellitus. Aliskiren is a direct renin inhibitor, which is expected to modify proangiogenic cells. This study aimed to investigate whether and how aliskiren could improve the function of
Kaori Narumi et al.
Scientific reports, 8(1), 16-16 (2018-01-10)
(Pro)renin receptor [(P)RR] is expressed in the kidney and is involved in renal injury. Although (P)RR is activated by indoxyl sulfate (IS) and may be related to renal injury, the details remain unclear. We used mouse mesangial cell line SV40
Heike Wanka et al.
Journal of cellular and molecular medicine, 21(7), 1394-1410 (2017-02-20)
The (pro)renin receptor [(P)RR, ATP6AP2] is a multifunctional transmembrane protein that activates local renin-angiotensin systems, but also interacts with Wnt pathways and vacuolar H
Nehman Makdissy et al.
Stem cell research & therapy, 9(1), 132-132 (2018-05-13)
The subcellular distribution of prorenin receptor and adaptor protein ATP6AP2 may affect neurogenesis. In this study, we hypothesized that ATP6AP2 expression and subcellular relocalization from caveolae/lipid raft microdomains (CLR-Ms) to intracellular sites may correlate with neuronal differentiation (Neu-Dif) of adipose-derived
Juan Wang et al.
British journal of cancer, 120(2), 229-237 (2018-12-18)
Although constitutive activating mutations in the Wnt/β-catenin signalling pathway are important for colorectal cancer development, canonical signalling through Wnt ligands is essential for β-catenin activation. Here, we investigated the role of (pro)renin receptor ((P)RR), a component of the Wnt receptor
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service