Skip to Content
Merck
All Photos(1)

Key Documents

EHU070891

Sigma-Aldrich

MISSION® esiRNA

targeting human PKP2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCAGAGCTCCTTCCACAGCACCCGCACGCTGAGGGAAGCTGGGCCCAGTGTCGCCGTGGATTCCAGCGGGAGGAGAGCGCACTTGACTGTCGGCCAGGCGGCCGCAGGGGGAAGTGGGAATCTGCTCACTGAGAGAAGCACTTTCACTGACTCCCAGCTGGGGAATGCAGACATGGAGATGACTCTGGAGCGAGCAGTGAGTATGCTCGAGGCAGACCACATGCTGCCATCCAGGATTTCTGCTGCAGCTACTTTCATACAGCACGAGTGCTTCCAGAAATCTGAAGCTCGGAAGAGGGTTAACCAGCTTCGTGGCATCCTCAAGCTTCTGCAGCTCCTAAAAGTTCAGAATGAAGACGTTCAGCGAGCTGTGTGTGGGGCCTTGAGAAACTTAGTATTTGAAGACAATGACAACAAATTGGAGGTGGCTGAACTAAATGGGGTACCTCGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Sorry, we don't have COAs for this product available online at this time.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Degeng Zhang et al.
Neuropathology : official journal of the Japanese Society of Neuropathology, 37(3), 207-216 (2017-01-27)
Glioma is the most common type of primary brain tumor in the CNS. Due to its poor prognosis and high mortality rates, it is urgent to find out more effective therapies. Plakophilin-2 (PKP2) is a widespread desmosomal plaque protein. Recently
Oxana E Nekrasova et al.
The Journal of cell biology, 195(7), 1185-1203 (2011-12-21)
The desmosomal cadherins, desmogleins (Dsgs) and desmocollins (Dscs), comprise the adhesive core of intercellular junctions known as desmosomes. Although these adhesion molecules are known to be critical for tissue integrity, mechanisms that coordinate their trafficking into intercellular junctions to regulate

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service