Skip to Content
Merck
All Photos(1)

Key Documents

EHU019931

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF11

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCCCGTAACAAGAGAGGAGTGATAATTAAAGGTTTAGAAGAAATTACAGTACACAACAAGGATGAAGTCTATCAAATTTTAGAAAAGGGGGCAGCAAAAAGGACAACTGCAGCTACTCTGATGAATGCATACTCTAGTCGTTCCCACTCAGTTTTCTCTGTTACAATACATATGAAAGAAACTACGATTGATGGAGAAGAGCTTGTTAAAATCGGAAAGTTGAACTTGGTTGATCTTGCAGGAAGTGAAAACATTGGCCGTTCTGGAGCTGTTGATAAGAGAGCTCGGGAAGCTGGAAATATAAATCAATCCCTGTTGACTTTGGGAAGGGTCATTACTGCCCTTGTAGAAAGAACACCTCATGTTCCTTATCGAGAATCTAAACTAACTAGAATCCTCCAGGATTCTCTTGGAGGGCGTACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wei Zhang et al.
Advanced healthcare materials, 5(12), 1493-1504 (2016-04-26)
Developing RNA-interference-based therapeutic approaches with efficient and targeted cytosolic delivery of small interfering RNA (siRNA) is remaining a critical challenge since two decades. Herein, a multifunctional transferrin receptor (TfR)-targeted siRNA delivery system (Tf&INF7) is designed based on siRNA complexes formed
Kai Zhu et al.
American journal of translational research, 11(4), 2245-2256 (2019-05-21)
Micro RNA (miRNAs) is a kind of non coding small RNAs with negative regulation function, which plays an important role in regulating the occurrence and development of tumors. In this study, we analyzed the expression level and role of miRNA-186-5p
Takeharu Imai et al.
Anticancer research, 37(1), 47-55 (2016-12-25)
Oesophageal squamous cell carcinoma (ESCC) and colorectal cancer (CRC) are common types of human cancer. Spheroid colony formation is used to characterize cancer stem cell (CSCs). In the present study, we analyzed the significance of kinesin family 11 (KIF11 in
Myles Fennell et al.
Assay and drug development technologies, 13(7), 347-355 (2015-08-13)
Uptake of nutrients, such as glucose and amino acids, is critical to support cell growth and is typically mediated by cell surface transporters. An alternative mechanism for the bulk uptake of nutrients from the extracellular space is macropinocytosis, a nonclathrin
Tatsuya Kato et al.
Molecular cancer research : MCR, 16(1), 47-57 (2017-10-11)
Inhibiting specific gene expression with siRNA provides a new therapeutic strategy to tackle many diseases at the molecular level. Recent strategies called high-density lipoprotein (HDL)-mimicking peptide-phospholipid nanoscaffold (HPPS) nanoparticles have been used to induce siRNAs-targeted delivery to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service