Skip to Content
Merck
All Photos(1)

Key Documents

EHU010651

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP12

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTCTTCCTTATGGCCAACCTTGCCATCTGGCATTGAAGCTGCTTATGAAATTGAAGCCAGAAATCAAGTTTTTCTTTTTAAAGATGACAAATACTGGTTAATTAGCAATTTAAGACCAGAGCCAAATTATCCCAAGAGCATACATTCTTTTGGTTTTCCTAACTTTGTGAAAAAAATTGATGCAGCTGTTTTTAACCCACGTTTTTATAGGACCTACTTCTTTGTAGATAACCAGTATTGGAGGTATGATGAAAGGAGACAGATGATGGACCCTGGTTATCCCAAACTGATTACCAAGAACTTCCAAGGAATCGGGCCTAAAATTGATGCAGTCTTCTACTCTAAAAACAAATACTACTATTTCTTCCAAGGATCTAACCAATTTGAATATGACTTCCTACTCCAACGTATCACCAAAACACTGAAAAGCA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bharath Chelluboina et al.
Scientific reports, 5, 9504-9504 (2015-05-09)
This study highlights the possible pathological role of MMP-12 in the context of ischemic stroke. Male rats were subjected to a two-hour middle cerebral artery occlusion (MCAO) procedure. MMP-12 shRNA expressing plasmid formulation was administered to these rats twenty-four hours
Seung Pil Yun et al.
British journal of pharmacology, 171(13), 3283-3297 (2014-03-19)
Reactive oxygen species (ROS) are potent regulators of stem cell behaviour; however, their physiological significance as regards MMP-mediated regulation of the motility of human umbilical cord blood-derived mesenchymal stem cells (UCB-MSCs) has not been characterized. In the present study, we

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service