Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EMU065851

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Skp2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCCTCGGCTGCAGATTAACTGCGCCTATTTCACCACCATTGCAAGGCCAACTATGGACAGCAAGAAGAACCTGGAGATTTGGGGTATCAAGTGCCGACTGACTCTGCAAAAGCCCAGTTGTCTATGAAGTGCTTACCGCAGAGCGGTGTTTCCTCTGGAACGAGGAAAGCAGGCAGCAAGTCCGCATGCTGGAGACCTTGGTTACTCTTCCTATTGGCTTTGCCTTAGCCTTCACTTTATATGTATGTTAGGGAACCATTTGCGAGGGGGACAGCCACGAAGTGTTACTTTTTCAAAACTATAGAGCCGATTCTGTCAGTGCTGTGCCCTAAGGGCCTAAGCGGCAGGTCTTTGGAGATTTTAGGAGAGCCTATGATTTCAGCATGCTTTTTTAAAAGCGACATTTGAGCCAAC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Haijin Chen et al.
Molecular medicine reports, 10(2), 1129-1135 (2014-06-11)
Colon cancer is a common type of malignancy in the digestive system. The aim of the present study was to investigate the role of S-phase kinase-associated protein 2 (Skp2) in colon carcinoma and to identify whether depletion of Skp2 by Skp2‑RNA interference
Ming Qi et al.
Molecular medicine reports, 11(5), 3934-3940 (2015-01-13)
In order to determine the protein expression of S‑phase kinase‑associated protein 2 (Skp2) and p27kip1, and to evaluate their possible prognostic values in malignant liver cancer, tissue samples from 50 patients and 40 controls were assessed and analyzed by immunohistochemistry
Wenfu Lu et al.
Oncotarget, 6(2), 771-788 (2015-01-19)
Aberrant elevation of JARID1B and histone H3 lysine 4 trimethylation (H3K4me3) is frequently observed in many diseases including prostate cancer (PCa), yet the mechanisms on the regulation of JARID1B and H3K4me3 through epigenetic alterations still remain poorly understood. Here we

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico