Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EMU058651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Aof2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTGCCCTCTGCAAGGAATATGATGAATTAGCTGAAACACAAGGAAAGCTAGAAGAAAAACTTCAAGAATTGGAAGCCAATCCCCCAAGTGATGTATACCTCTCATCAAGAGACAGACAAATACTTGACTGGCATTTTGCAAATCTTGAATTTGCCAACGCCACACCTCTCTCTACCCTCTCTCTTAAACATTGGGATCAGGATGATGACTTTGAGTTTACTGGAAGCCACCTGACAGTAAGGAATGGCTACTCATGTGTGCCTGTGGCTTTAGCTGAAGGCTTGGACATTAAACTGAACACAGCAGTGCGGCAGGTTCGCTACACAGCCTCAGGATGTGAAGTGATTGCTGTGAACACACGTTCCACAAGTCAAACCTTTATTTATAAGTGTGATGCAGTTCTCTGTACACTTCCTTTGGGAGTGTTGAAGCAGCAGCCACCAGCTGTTCAGTTTGTGCCACCTCTTCCTGAGTGGAAAACATCTGCAGTCCAAAGGATGGGATTTGGCAACCTTAACAAGGTGGTGTTATGCTTTGACCGTGTGTTCTGGGACCCAAGT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Melissa M Singh et al.
Neuro-oncology, 17(11), 1463-1473 (2015-03-22)
Glioblastoma (GBM) is the most common and aggressive form of brain cancer. Our previous studies demonstrated that combined inhibition of HDAC and KDM1A increases apoptotic cell death in vitro. However, whether this combination also increases death of the glioma stem
Ghanshyam Upadhyay et al.
Proceedings of the National Academy of Sciences of the United States of America, 111(22), 8071-8076 (2014-05-21)
Lysine-specific demethylase 1 (LSD1) demethylates nucleosomal histone H3 lysine 4 (H3K4) residues in collaboration with the corepressor CoREST/REST corepressor 1 (Rcor1) and regulates cell fates by epigenetically repressing gene targets. The balanced regulation of this demethylase, if any, is however
Stefano Amente et al.
Oncotarget, 6(16), 14572-14583 (2015-06-13)
The chromatin-modifying enzyme lysine-specific demethylase 1, KDM1A/LSD1 is involved in maintaining the undifferentiated, malignant phenotype of neuroblastoma cells and its overexpression correlated with aggressive disease, poor differentiation and infaust outcome. Here, we show that LSD1 physically binds MYCN both in
Sathiya Pandi Narayanan et al.
Cancer letters, 367(2), 162-172 (2015-08-01)
The histone demethylase KDM1A specifically demethylates lysine residues and its deregulation has been implicated in the initiation and progression of various cancers. However, KDM1A's molecular role and its pathological consequences, and prognostic significance in oral cancer remain less understood. In

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico