Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU101361

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP3K3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGAGGTGAGTGCTCTGGAGTGCGAGATCCAGTTGCTAAAGAACTTGCAGCATGAGCGCATCGTGCAGTACTATGGCTGTCTGCGGGACCGCGCTGAGAAGACCCTGACCATCTTCATGGAGTACATGCCAGGGGGCTCGGTGAAAGACCAGTTGAAGGCTTACGGTGCTCTGACAGAGAGCGTGACCCGAAAGTACACGCGGCAGATCCTGGAGGGCATGTCCTACCTGCACAGCAACATGATTGTTCACCGGGACAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yue Zheng et al.
FEBS letters, 591(15), 2290-2298 (2017-06-24)
Lineage-negative bone marrow cells (lin-BMCs) have reparative potential for overcoming endothelial dysfunction and reducing cardiovascular risk. Here, we found that miR-188 is upregulated and mitogen-activated protein kinase kinase kinase 3 (MAP3K3) is downregulated in aged lin-BMCs, whereas their expression is reversed
Longping Yao et al.
Journal of neuroinflammation, 15(1), 13-13 (2018-01-14)
Parkinson's disease (PD) is the most prevalent neurodegenerative disorder that is characterised by selective loss of midbrain dopaminergic (DA) neurons. Chronic inflammation of the central nervous system is mediated by microglial cells and plays a critical role in the pathological
Ganesh Umapathy et al.
Science signaling, 7(349), ra102-ra102 (2014-10-30)
Anaplastic lymphoma kinase (ALK) is an important molecular target in neuroblastoma. Although tyrosine kinase inhibitors abrogating ALK activity are currently in clinical use for the treatment of ALK-positive (ALK(+)) disease, monotherapy with ALK tyrosine kinase inhibitors may not be an

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico