Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU082281

Sigma-Aldrich

MISSION® esiRNA

targeting human TEK

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTCCCTCCTCCAAGAGGTCTAAATCTCCTGCCTAAAAGTCAGACCACTCTAAATTTGACCTGGCAACCAATATTTCCAAGCTCGGAAGATGACTTTTATGTTGAAGTGGAGAGAAGGTCTGTGCAAAAAAGTGATCAGCAGAATATTAAAGTTCCAGGCAACTTGACTTCGGTGCTACTTAACAACTTACATCCCAGGGAGCAGTACGTGGTCCGAGCTAGAGTCAACACCAAGGCCCAGGGGGAATGGAGTGAAGATCTCACTGCTTGGACCCTTAGTGACATTCTTCCTCCTCAACCAGAAAACATCAAGATTTCCAACATTACACACTCCTCAGCTGTGATTTCTTGGACAATATTGGATGGCTATTCTATTTCTTCTATTACTATCCGTTACAAGGTTCAAGGCAAGAATGAAGACCAGCACGTTGATGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Adam C Mirando et al.
JCI insight, 4(4) (2019-01-23)
The angiopoietin (Ang)/Tie2 signaling pathway is essential for maintaining vascular homeostasis, and its dysregulation is associated with several diseases. Interactions between Tie2 and α5β1 integrin have emerged as part of this control; however, the mechanism is incompletely understood. AXT107, a
Kaihong Zeng et al.
Molecular and cellular biochemistry, 396(1-2), 239-248 (2014-07-26)
Previously, we confirmed that taurine prevented diabetes-induced apoptosis in retinal glial cells via its anti-oxidation and anti-glutamate excitotoxicity mechanisms. The aim of this study is to investigate the effects of taurine on angiopoietin-2 (Ang-2)/Tie-2 system expressions and apoptosis in high
Martin Teichert et al.
Nature communications, 8, 16106-16106 (2017-07-19)
The Tie receptors with their Angiopoietin ligands act as regulators of angiogenesis and vessel maturation. Tie2 exerts its functions through its supposed endothelial-specific expression. Yet, Tie2 is also expressed at lower levels by pericytes and it has not been unravelled

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico