Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU048931

Sigma-Aldrich

MISSION® esiRNA

targeting human PIM2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGCATCCTCCTCTATGACATGGTGTGTGGGGACATTCCCTTTGAGAGGGACCAGGAGATTCTGGAAGCTGAGCTCCACTTCCCAGCCCATGTCTCCCCAGACTGCTGTGCCCTAATCCGCCGGTGCCTGGCCCCCAAACCTTCTTCCCGACCCTCACTGGAAGAGATCCTGCTGGACCCCTGGATGCAAACACCAGCCGAGGATGTACCCCTCAACCCCTCCAAAGGAGGCCCTGCCCCTTTGGCCTGGTCCTTGCTACCCTAAGCCTGGCCTGGCCTGGCCTGGCCCCCAATGGTCAGAAGAGCCATCCCATGGCCATGTCACAGGGATAGATGGACATTTGTTGACTTGGTTTTACAGGTCATTACCAGTCATTAAAGTCCAGTATTACTAAGGTAAGGGATTGAGGATCAGGGGTTAGAAGACATAAACCAAGTCTGCCCAGTTCCCTTC

Ensembl | human accession no.

ENSG00000102096

NCBI accession no.

NM_006875

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PIM2(11040) , PIM2(11040)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

J R Nair et al.
Leukemia, 31(8), 1715-1726 (2016-12-23)
The PIM kinase family (PIM1, 2 and 3) have a central role in integrating growth and survival signals, and are expressed in a wide range of solid and hematological malignancies. We now confirm that PIM2 is overexpressed in multiple myeloma
Tingting Yang et al.
Oncogene, 37(45), 5997-6009 (2018-07-10)
Hexokinase-II (HK2) is a key enzyme involved in glycolysis, which is required for breast cancer progression. However, the underlying post-translational mechanisms of HK2 activity are poorly understood. Here, we showed that Proviral Insertion in Murine Lymphomas 2 (PIM2) directly bound
Zhaoyun Liu et al.
Oncology letters, 17(6), 5395-5402 (2019-06-13)
PIM2 proto-oncogene, serine/threonine kinase (PIM2) is a serine/threonine protein kinase that is upregulated in different types of cancer and serves essential roles in the regulation of signal transduction cascades, which promote cell survival and cell proliferation. The present study demonstrated
Chune Ren et al.
Molecular oncology, 12(5), 690-704 (2018-03-24)
Tristetraprolin (TTP) is an AU-rich element-binding protein that regulates mRNA stability and plays important roles in cancer. The mechanisms by which TTP is regulated in breast cancer are poorly understood. Using multiple biochemical approaches, we found that proviral insertion in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico