Todas las fotos(1)

Key Documents

Certificado de origen (COO)/COA

EHU035471

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human PNPLA2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Todas las fotos(1)

About This Item

UNSPSC Code:

41105324

NACRES:

NA.51

description

product line

MISSION^®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGCCAAGTTCATTGAGGTATCTAAAGAGGCCCGGAAGCGGTTCCTGGGCCCCCTGCACCCCTCCTTCAACCTGGTAAAGATCATCCGCAGTTTCCTGCTGAAGGTCCTGCCTGCTGATAGCCATGAGCATGCCAGTGGGCGCCTGGGCATCTCCCTGACCCGCGTGTCAGACGGCGAGAATGTCATTATATCCCACTTCAACTCCAAGGACGAGCTCATCCAGGCCAATGTCTGCAGCGGTTTCATCCCCGTGTACTGTGGGCTCATCCCTCCCTCCCTCCAGGGGGTGCGCTACGTGGATGGTGGCATTTCAGACAACCTGCCACTCTATGAGCTTAAGAACACCATCACAGTGTCCCCCTTCTCGGGCGAGAGTGACATCTGTCCGCAGGACAGCTCCACCAACATC

Ensembl | human accession no.

ENSG00000177666

NCBI accession no.

NM_020376

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PNPLA2(57104) , PNPLA2(57104)

Categorías relacionadas

MISSION® esiRNA

General description

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

α2AP regulates vascular alteration by inhibiting VEGF signaling in systemic sclerosis: the roles of α2AP in vascular dysfunction in systemic sclerosis.

Yosuke Kanno et al.

Arthritis research & therapy, 19(1), 22-22 (2017-02-06)

Systemic sclerosis (SSc) is a connective tissues disease of unknown origin characterized by vascular damage and extensive fibrosis. Recently, we demonstrated that α2-antiplasmin (α2AP) is associated with the development of fibrosis in SSc. We herein investigate the roles of α2AP

Reduced expression of adipose triglyceride lipase decreases arachidonic acid release and prostacyclin secretion in human aortic endothelial cells.

Monika Riederer et al.

Archives of physiology and biochemistry, 123(4), 249-253 (2017-04-04)

Vascular endothelial cells represent an important source of arachidonic acid (AA)-derived mediators involved in the generation of anti- or proatherogenic environments. Evidence emerged (in mast cells), that in addition to phospholipases, neutral lipid hydrolases as adipose triglyceride lipase (ATGL) also

Repression of exogenous gene expression by the retinoic acid target gene G0S2.

Tian Ma et al.

International journal of oncology, 42(5), 1743-1753 (2013-04-03)

The G0/G1 switch gene 2 (G0S2) is rapidly induced by all-trans-retinoic acid (RA)-treatment of acute promyelocytic leukemia (APL) and other cells. G0S2 regulates lipolysis via inhibition of adipose triglyceride lipase (ATGL). This study found that retinoic acid receptor (RAR), but

Pigment Epithelium-Derived Factor (PEDF) Receptors Are Involved in Survival of Retinal Neurons.

Susanne Bürger et al.

International journal of molecular sciences, 22(1) (2021-01-06)

The demise of retinal ganglion cells (RGCs) is characteristic of diseases of the retina such as glaucoma and diabetic or ischemic retinopathies. Pigment epithelium-derived factor (PEDF) is a multifunctional secreted protein that mediates neuroprotection and inhibition of angiogenesis in the

Muscle-specific deletion of comparative gene identification-58 (CGI-58) causes muscle steatosis but improves insulin sensitivity in male mice.

Ping Xie et al.

Endocrinology, 156(5), 1648-1658 (2015-03-10)

Intramyocellular accumulation of lipids is often associated with insulin resistance. Deficiency of comparative gene identification-58 (CGI-58) causes cytosolic deposition of triglyceride (TG)-rich lipid droplets in most cell types, including muscle due to defective TG hydrolysis. It was unclear, however, whether

Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico