MilliporeSigma
  • Home
  • Search Results
  • DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi.

DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi.

Bioelectrochemistry (Amsterdam, Netherlands) (2015-04-29)
Anu Singh, Meenakshi Choudhary, M P Singh, H N Verma, Surinder P Singh, Kavita Arora
ABSTRACT

Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.

MATERIALS
Product Number
Brand
Product Description

Sigma-Aldrich
Potassium chloride, ≥99.99% trace metals basis
Sigma-Aldrich
Potassium chloride, 99.999% trace metals basis
Sigma-Aldrich
Sodium trichloroacetate, 97%
Sigma-Aldrich
Ethanolamine, ACS reagent, ≥99.0%
Sigma-Aldrich
11-Mercaptoundecanoic acid, 95%
Sigma-Aldrich
Ethanolamine, ≥98%
Sigma-Aldrich
Ethanolamine, liquid, BioReagent, suitable for cell culture, ≥98%
Sigma-Aldrich
Potassium chloride solution, 0.075 M, sterile-filtered, BioXtra, suitable for cell culture
Sigma-Aldrich
Potassium chloride, for molecular biology, ≥99.0%
Sigma-Aldrich
Potassium chloride, BioXtra, ≥99.0%
Sigma-Aldrich
Potassium chloride, powder, BioReagent, suitable for cell culture, suitable for insect cell culture, ≥99.0%
Sigma-Aldrich
Trichloroacetic acid, ACS reagent, for the determination of Fe in blood according to Heilmeyer, ≥99.5%
Sigma-Aldrich
Potassium chloride, BioUltra, for molecular biology, ≥99.5% (AT)
Sigma-Aldrich
Potassium chloride, AnhydroBeads, −10 mesh, 99.99% trace metals basis
Sigma-Aldrich
Potassium chloride, AnhydroBeads, −10 mesh, 99.999% trace metals basis
Sigma-Aldrich
Trichloroacetic acid, BioUltra, ≥99.5% (T)
Sigma-Aldrich
Trichloroacetic acid, suitable for electrophoresis, suitable for fixing solution (for IEF and PAGE gels), ≥99%
Sigma-Aldrich
Trichloroacetic acid, ≥99.0% (titration)
Sigma-Aldrich
Trichloroacetic acid, ACS reagent, ≥99.0%
Sigma-Aldrich
Trichloroacetic acid, BioXtra, ≥99.0%
Sigma-Aldrich
Acetone, ≥99%, meets FCC analytical specifications
Sigma-Aldrich
Ethanolamine, purified by redistillation, ≥99.5%
Sigma-Aldrich
Acetone, natural, ≥97%
Sigma-Aldrich
Acetone, suitable for HPLC, ≥99.9%
Sigma-Aldrich
Potassium chloride solution, BioUltra, for molecular biology, ~1 M in H2O
Sigma-Aldrich
Ethanolamine, ≥99%
SAFC
Ethanolamine
Sigma-Aldrich
11-Mercaptoundecanoic acid, 98%
Sigma-Aldrich
Trichloroacetic acid solution, 6.1 N
Sigma-Aldrich
N-Hydroxysuccinimide, 98%