Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU226031

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF9, RP11-468E2.4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGCTGTCTGGAAGACTCGCCTGCGCTGTGCACTCAACAAGAGTTCTGAATTTAAGGAGGTTCCTGAGAGGGGCCGCATGGATGTTGCTGAGCCCTACAAGGTGTATCAGTTGCTGCCACCAGGAATCGTCTCTGGCCAGCCAGGGACTCAGAAAGTACCATCAAAGCGACAGCACAGTTCTGTGTCCTCTGAGAGGAAGGAGGAAGAGGATGCCATGCAGAACTGCACACTCAGTCCCTCTGTGCTCCAGGACTCCCTCAATAATGAGGAGGAGGGGGCCAGTGGGGGAGCAGTCCATTCAGACATTGGGAGCAGCAGCAGCAGCAGCAGCCCTGAGCCACAGGAAGTTACAGACACAACTGAGGCCCCCTTTCAAGGGGATCAGAGGTCCCTGGAGTTTCTGCTTCCTCCAGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nicholas Hernandez et al.
The Journal of experimental medicine, 215(10), 2567-2585 (2018-08-26)
Life-threatening pulmonary influenza can be caused by inborn errors of type I and III IFN immunity. We report a 5-yr-old child with severe pulmonary influenza at 2 yr. She is homozygous for a loss-of-function IRF9 allele. Her cells activate gamma-activated
Nadiia Lypova et al.
Cancers, 11(5) (2019-05-19)
While clinical responses to palbociclib have been promising, metastatic breast cancer remains incurable due to the development of resistance. We generated estrogen receptor-positive (ER+) and ER-negative (ER-) cell line models and determined their permissiveness and cellular responses to an oncolytic
Adriana Forero et al.
Immunity, 51(3), 451-464 (2019-09-01)
Type I and III interferons (IFNs) activate similar downstream signaling cascades, but unlike type I IFNs, type III IFNs (IFNλ) do not elicit strong inflammatory responses in vivo. Here, we examined the molecular mechanisms underlying this disparity. Type I and III
Marieke C Verweij et al.
PLoS pathogens, 11(5), e1004901-e1004901 (2015-05-15)
Varicella zoster virus (VZV) causes chickenpox in humans and, subsequently, establishes latency in the sensory ganglia from where it reactivates to cause herpes zoster. Infection of rhesus macaques with simian varicella virus (SVV) recapitulates VZV pathogenesis in humans thus representing

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service