Skip to Content
Merck
All Photos(1)

Key Documents

EHU155971

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGTGTTCAAGGACCATCCCCAGGGCACAGAACCTGATATGTACAAATATGATGCCTATTTGTGCTTCAGCAGCAAAGACTTCACATGGGTGCAGAATGCTTTGCTCAAACACCTGGACACTCAATACAGTGACCAAAACAGATTCAACCTGTGCTTTGAAGAAAGAGACTTTGTCCCAGGAGAAAACCGCATTGCCAATATCCAGGATGCCATCTGGAACAGTAGAAAGATCGTTTGTCTTGTGAGCAGACACTTCCTTAGAGATGGCTGGTGCCTTGAAGCCTTCAGTTATGCCCAGGGCAGGTGCTTATCTGACCTTAACAGTGCTCTCATCATGGTGGTGGTTGGGTCCTTGTCCCAGTACCAGTTGATGAAACATCAATCCATCAGAGGCTTTGTACAGAAACAGCAGTATTTGAGGTGGCCTGAGGATTTCCAGGATGTTGGCTGGTTTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Li-Juan Ji et al.
Journal of cellular biochemistry, 119(1), 1017-1026 (2017-07-08)
MicroRNAs (miRNAs) are reported as vital participators in the pathophysiological course of neuropathic pain. However, the underlying mechanisms of the functional roles of miRNAs in neuropathic pain are largely unknown. This study was designed to explore the potential role of
Signaling Mediated by Toll-
Maria Del Mar Cendra et al.
Frontiers in cellular and infection microbiology, 7, 130-130 (2017-05-05)
Tanay Bhatt et al.
Cell reports, 29(9), 2546-2555 (2019-11-28)
Antimicrobial peptides (AMPs) are the body's natural innate immune defense against a spectrum of pathogens and can also modulate cell proliferation, chemotaxis, angiogenesis, wound healing, and immune cell activity. Harnessing these diverse functions for prophylactic use is contingent upon understanding

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service