Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU066761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fyb

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCCTCAGACTTCCCTCCTCCACCTGCAGAGATGAGTCAAGGAATGAGTGTTGGAAGGGCAAAAACGGAAGAGAAAGATCCCAAGAAGCTAAAAAAGCAAGAAAAGGAAGAAAAAGACCTCAGGAAAAAATTTAAGTACGACGGTGAAATTCGAGTTCTATATTCAACTAAAGTTGCGTCCTCCTTAACCTCTAAAAAGTGGGGAGCGAGAGATCTGCAGATAAAACCTGGGGAGTCACTCGAAGTTATACAAAGCACAGATGACACCAAAGTTCTCTGCAGGAATGAAGAGGGCAAATATGGTTATGTCCTTCGGAGTTACCTGGTGGACAATGATGGAGAAATCTATGACGACATCGCTGATGGTTGCATCTATGACAATGACTAGCACTCTGCTCTGTTCATTCCACTGTGCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fang Wang et al.
Folia histochemica et cytobiologica, 58(2), 96-107 (2020-06-27)
Growing evidence indicates that Rictor (Rapamycin-insensitive companion of mTOR) is overexpressed across several malignancies and associated with poor survival. However, only limited data indicate that Rictor plays a role in gastric cancer (GC). We sought to explore the prognostic value
Li Feng et al.
Pharmaceutical biology, 57(1), 586-594 (2019-09-08)
Context: Evidence suggests that microRNA (miRNA) regulate gene expression and bone tissue homoeostasis of osteoporosis. MiR-152 has found to be abnormally expressed in osteoporosis, but its role in osteoblast differentiation has not been elucidated. Objective: To understand the potential mechanism
Mahmoud A Chawsheen et al.
Cellular signalling, 81, 109934-109934 (2021-02-06)
Lung cancer has a poor prognosis partly due to a lack of response to treatments such as the chemotherapy drug gemcitabine. Combinations of chemotherapy drugs with signal transduction inhibitors may be more effective treatments. In this study we have investigated
Zheng Guo et al.
Oncology reports, 45(2), 523-534 (2021-01-09)
Colorectal cancer (CRC) is a common cancer worldwide, and its treatment strategies are limited. The underlying mechanism of CRC progression remains to be determined. Telomere maintenance 2 (TELO2) is a mTOR‑interacting protein. Both the role and molecular mechanism of TELO2 in cancer
Sarah A Cook et al.
Science (New York, N.Y.), 369(6500), 202-207 (2020-07-11)
Immunodeficiency often coincides with hyperactive immune disorders such as autoimmunity, lymphoproliferation, or atopy, but this coincidence is rarely understood on a molecular level. We describe five patients from four families with immunodeficiency coupled with atopy, lymphoproliferation, and cytokine overproduction harboring

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service