Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU109701

Sigma-Aldrich

MISSION® esiRNA

targeting human HSP90B1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

AAGGGTGTGGTGGACTCAGATGATCTCCCCTTGAATGTTTCCCGCGAGACTCTTCAGCAACATAAACTGCTTAAGGTGATTAGGAAGAAGCTTGTTCGTAAAACGCTGGACATGATCAAGAAGATTGCTGATGATAAATACAATGATACTTTTTGGAAAGAATTTGGTACCAACATCAAGCTTGGTGTGATTGAAGACCACTCGAATCGAACACGTCTTGCTAAACTTCTTAGGTTCCAGTCTTCTCATCATCCAACTGACATTACTAGCCTAGACCAGTATGTGGAAAGAATGAAGGAAAAACAAGACAAAATCTACTTCATGGCTGGGTCCAGCAGAAAAGAGGCTGAATCTTCTCCATTTGTTGAGCGACTTCTGAAAAAGGGCTATGAAGTTATTTACCTCACAGAACCTGTGGATGAATACTGTATTCAGGCCCTTCCCGAATTTGATGGGAAGAGGTTCCAG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000166598

numer dostępu NCBI

NM_003299

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... HSP90B1(7184) , HSP90B1(7184)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Pedro Buc Calderon et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 105, 115-120 (2018-06-01)
Grp94 plays an essential role in protein assembly. We previously suggested that Grp94 overexpression is involved in tumor aggressiveness. However, the underlying mechanisms remain unknown. Since many tumors display high Grp94 levels, we investigated the effects of tumor microenvironment on
Qun Wei et al.
Biochemical and biophysical research communications, 511(1), 92-98 (2019-02-17)
Vascular endothelial cell (VEC) apoptosis takes part in the development of various cardiovascular diseases. Heat shock protein 90 (HSP90) regulates apoptosis through various apoptosis associated client proteins. In previous study, we identified a novel HSP90 inhibitor HCP1 induced apoptosis in
Naiara Santana-Codina et al.
International journal of molecular sciences, 20(16) (2019-08-10)
Metabolic adaptation may happen in response to the pressure exerted by the microenvironment and is a key step in survival of metastatic cells. Brain metastasis occurs as a consequence of the systemic dissemination of tumor cells, a fact that correlates
Sha She et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(2), 741-752 (2018-07-20)
C reactive protein (CRP) levels are elevated in many diseases, including malignant tumors and cardiovascular disorders. In this study, the protein interaction network for CRP was evaluated to determine the importance of CRP and its interacting proteins in the molecular
Lipeng Xiong et al.
Journal of proteomics, 182, 34-44 (2018-05-08)
A Disintegrin And Metalloproteinase 12 (ADAM12) is highly expressed in multiple cancers such as breast and cervical cancers and its high expression reduces the overall patient survival rate. ADAM12 has two major splicing variants, the long membrane-anchored form ADAM12L and

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej