Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU099501

Sigma-Aldrich

MISSION® esiRNA

targeting human F11R

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCCTTTCCTACCACTGCTGAGTGGCCTGGAACTTGTTTAAAGTGTTTATTCCCCATTTCTTTGAGGGATCAGGAAGGAATCCTGGGTATGCCATTGACTTCCCTTCTAAGTAGACAGCAAAAATGGCGGGGGTCGCAGGAATCTGCACTCAACTGCCCACCTGGCTGGCAGGGATCTTTGAATAGGTATCTTGAGCTTGGTTCTGGGCTCTTTCCTTGTGTACTGACGACCAGGGCCAGCTGTTCTAGAGCGGGAATTAGAGGCTAGAGCGGCTGAAATGGTTGTTTGGTGATGACACTGGGGTCCTTCCATCTCT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000158769

numer dostępu NCBI

NM_144504

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... F11R(50848) , F11R(50848)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jonas Franz et al.
PloS one, 11(1), e0146598-e0146598 (2016-01-06)
Endothelial barriers have a central role in inflammation as they allow or deny the passage of leukocytes from the vasculature into the tissue. To bind leukocytes, endothelial cells form adhesive clusters containing tetraspanins and ICAM-1, so-called endothelial adhesive platforms (EAPs).
Min Xie et al.
Cancer letters, 443, 67-79 (2018-12-07)
Multiple studies have revealed that long non-coding RNAs (lncRNAs) extensively participate in human cancer malignant progression. The long intergenic non-protein coding RNA 707 (LINC00707), 3087 bp in length, was recently reported to be an essential oncogene in promoting lung adenocarcinoma
Rodrigo G B Cruz et al.
Cancers, 13(4) (2021-03-07)
The success of breast cancer therapies targeting the human epidermal growth factor receptor-2 (HER2) is limited by the development of drug resistance by mechanisms including upregulation of HER3. Having reported that HER2 expression and resistance to HER2-targeted therapies can be
Nikola Sladojevic et al.
Neurobiology of disease, 67, 57-70 (2014-03-25)
Proinflammatory mediators trigger intensive postischemic inflammatory remodeling of the blood-brain barrier (BBB) including extensive brain endothelial cell surface and junctional complex changes. Junctional adhesion molecule-A (JAM-A) is a component of the brain endothelial junctional complex with dual roles: paracellular route
Hüseyin Tuncay et al.
Nature communications, 6, 8128-8128 (2015-08-27)
Planar spindle orientation in polarized epithelial cells depends on the precise localization of the dynein-dynactin motor protein complex at the lateral cortex. The contribution of cell adhesion molecules to the cortical localization of the dynein-dynactin complex is poorly understood. Here

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej