Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU090371

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAGCACGTACACAGCCCTAATCATAGCTACAGACAATGGTTCTCCAGTTGCTACTGGAACAGGGACACTTCTGCTGATCCTGTCTGATGTGAATGACAACGCCCCCATACCAGAACCTCGAACTATATTCTTCTGTGAGAGGAATCCAAAGCCTCAGGTCATAAACATCATTGATGCAGACCTTCCTCCCAATACATCTCCCTTCACAGCAGAACTAACACACGGGGCGAGTGCCAACTGGACCATTCAGTACAACGACCCAACCCAAGAATCTATCATTTTGAAGCCAAAGATGGCCTTAGAGGTGGGTGACTACAAAATCAATCTCAAGCTCATGGATAACCAGAATAAAGACCAAGTGACCACCTTAGAGGTCAGCGTGTGTGACTGTGAAGGGGCCGCTGGCGTCTGTAGGAAGGCACAGCCT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000039068

numer dostępu NCBI

NM_004360

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CDH1(999) , CDH1(999)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Anchalee Techasen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(9), 8645-8652 (2014-05-29)
Tumor progression is characterized by loss of cell adhesion and increase of invasion and metastasis. E-cadherin, a cell adhesion molecule, is frequently downregulated and has been proposed as an important mediator in epithelial-mesenchymal transition (EMT) in tumors. In this study
Branka Petrić Miše et al.
Pathology oncology research : POR, 21(2), 347-356 (2014-08-12)
To analyze correlation between immunoexpression of E-cadherin and efficacy of first line platinum-based chemotherapy in patients with advanced-stage high-grade serous ovarian carcinoma. The expression of E-cadherin was analyzed immunohistochemically in formalin-fixed, paraffin-embedded samples from 98 patients with advanced-stage high-grade serous
Vikas Bhardwaj et al.
Oncotarget, 6(3), 1531-1543 (2015-01-22)
H. pylori infection is the strongest known risk factor for gastric cancer. Inhibition of host tumor suppressor mechanisms by the bacteria underlies the development of this disease. Among the tumor suppressors affected by H. pylori are p53 and E-cadherin, which
Shuai Xiao et al.
Digestive diseases and sciences, 60(4), 910-918 (2014-11-05)
Epithelial-mesenchymal transition (EMT) plays an important role in hepatocellular carcinoma (HCC) dissemination. Bromodomain PHD-finger transcription factor (BPTF) could regulate embrogenesis and stem cell differentiation, and it may be involved in tumor progression and EMT. In this study, we aimed to
Alex Chernyavsky et al.
International immunopharmacology, 29(1), 76-80 (2015-05-24)
The mechanism of detachment and death of keratinocytes in pemphigus vulgaris (PV) involves pro-apoptotic action of constellations of autoantibodies determining disease severity and response to treatment. The presence of antibodies to nicotinic acetylcholine receptors (nAChRs) and the therapeutic efficacy of
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej