Wszystkie zdjęcia(1)

Key Documents

Świadectwo pochodzenia/Certyfikat analizy (COA)

EHU090231

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human REST

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych

Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:

41105324

NACRES:

NA.51

opis

linia produktu

MISSION^®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GAGCGAGTATCACTGGAGGAAACATTTAAGAAACCATTTTCCAAGGAAAGTATACACATGTGGAAAATGCAACTATTTTTCAGACAGAAAAAACAATTATGTTCAGCATGTTAGAACTCATACAGGAGAACGCCCATATAAATGTGAACTTTGTCCTTACTCAAGTTCTCAGAAGACTCATCTAACTAGACATATGCGTACTCATTCAGGTGAGAAGCCATTTAAATGTGATCAGTGCAGTTATGTGGCCTCTAATCAACATGAAGTAACCCGCCATGCAAGACAGGTTCACAATGGGCCTAAACCTCTTAATTGCCCACACTGTGATTACAAAACAGCAGATAGAAGCAACTTCAAAAAACATGTAGAGCTACATGTGAACCCACGGCAGTTCAATTGCCCTGTATGTGACTATGCAGCTTCCAAG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000084093

numer dostępu NCBI

NM_005612

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... REST(5978) , REST(5978)

Powiązane kategorie

MISSION® esiRNA

Opis ogólny

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Scaffold mediated gene knockdown for neuronal differentiation of human neural progenitor cells.

Wai Hon Chooi et al.

Biomaterials science, 6(11), 3019-3029 (2018-10-03)

The use of human induced pluripotent stem cell-derived neural progenitor cells (hiPSC-NPCs) is an attractive therapeutic option for damaged nerve tissues. To direct neuronal differentiation of stem cells, we have previously developed an electrospun polycaprolactone nanofiber scaffold that was functionalized

Gene Silencing Mediated by siRNA-binding Fusion Proteins Is Attenuated by Double-stranded RNA-binding Domain Structure.

James C Geoghegan et al.

Molecular therapy. Nucleic acids, 1, e53-e53 (2012-01-01)

Delivery of small interfering RNA (siRNA) targeted to specific cell types is a significant challenge for the development of RNA interference-based therapeutics. Recently, PTD-DRBD, a double-stranded RNA binding domain (DRBD) fused to the TAT protein transduction domain (PTD), was shown

The differentiation of human MSCs derived from adipose and amniotic tissues into insulin-producing cells, induced by PEI@Fe3O4 nanoparticles-mediated NRSF and SHH silencing.

Rui Wang et al.

International journal of molecular medicine, 42(5), 2831-2838 (2018-08-23)

Type 1 diabetes involves the immunologically mediated destruction of insulin‑producing cells (IPCs) in the pancreatic islet. Mesenchymal stem cells (MSCs) have the ability to differentiate into IPCs and have become the most promising means for diabetes therapy. The present study

MicroRNA miR-29c down-regulation leading to de-repression of its target DNA methyltransferase 3a promotes ischemic brain damage.

Gopal Pandi et al.

PloS one, 8(3), e58039-e58039 (2013-03-22)

Recent studies showed that stroke extensively alters cerebral microRNA (miRNA) expression profiles and several miRNAs play a role in mediating ischemic pathophysiology. We currently evaluated the significance of miR-29c, a highly expressed miRNA in rodent brain that was significantly down-regulated

Temporal control of a dendritogenesis-linked gene via REST-dependent regulation of nuclear factor I occupancy.

Wei Wang et al.

Molecular biology of the cell, 22(6), 868-879 (2011-01-29)

Developing neurons undergo a series of maturational stages, and the timing of these events is critical for formation of synaptic circuitry. Here we addressed temporal regulation of the Gabra6 gene, which is expressed in a delayed manner during dendritogenesis in

Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej