Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU035251

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNN4

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GAGAGGCAGGCTGTTAATGCCACTGGGCACCTTTCAGACACACTTTGGCTGATCCCCATCACATTCCTGACCATCGGCTATGGTGACGTGGTGCCGGGCACCATGTGGGGCAAGATCGTCTGCCTGTGCACTGGAGTCATGGGTGTCTGCTGCACAGCCCTGCTGGTGGCCGTGGTGGCCCGGAAGCTGGAGTTTAACAAGGCAGAGAAGCACGTGCACAACTTCATGATGGATATCCAGTATACCAAAGAGATGAAGGAGTCCGCTGCCCGAGTGCTACAAGAAGCCTGGATGTTCTACAAACATACTCGCAGGAAGGAGTCTCATGCTGCCCGCAGGCATCAGCGCAAGCTGCTGGCCGCCATCAACGCGTTCCGCCAGGTGCGGCTGAAACACCGGAAGCTCCGGGAACAAGTGAACTCCATGGTGGACATCTCCAAGATGCACATGATCCTGTATGACCTGCAGCAGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000104783

numer dostępu NCBI

NM_002250

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... KCNN4(3783) , KCNN4(3783)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yu-Dong Fei et al.
Theranostics, 9(22), 6396-6411 (2019-10-08)
Effective therapeutic targets against post-myocardial infarction (MI) arrhythmias remain to be discovered. We aimed to investigate the role of macrophages in post-MI arrhythmias. Methods: Mononuclear cell accumulation, macrophage polarization from M0 to M1 subset, and gap junction formation were analyzed
Alban Girault et al.
Respiratory research, 16, 100-100 (2015-09-04)
Extensive alveolar epithelial injury and remodelling is a common feature of acute lung injury and acute respiratory distress syndrome (ARDS) and it has been established that epithelial regeneration, and secondary lung oedema resorption, is crucial for ARDS resolution. Much evidence
Chunling Huang et al.
Scientific reports, 6, 23884-23884 (2016-04-01)
Autophagy is emerging as an important pathway in many diseases including diabetic nephropathy. It is acknowledged that oxidative stress plays a critical role in autophagy dysfunction and diabetic nephropathy, and KCa3.1 blockade ameliorates diabetic renal fibrosis through inhibiting TGF-β1 signaling
Yu Liu et al.
Journal of Cancer, 6(7), 643-651 (2015-06-17)
The intermediate conductance calcium-activated potassium channel KCa3.1 plays an important role in regulating cell proliferation and migration. However, the role of KCa3.1 channel in human hepatocellular carcinoma remained unknown. This study was therefore performed to investigate the effects of KCa3.1
Etmar Bulk et al.
Oncotarget, 8(68), 112268-112282 (2018-01-20)
Early metastasis leads to poor prognosis of lung cancer patients, whose 5-year survival rate is only 15%. We could recently show that the Ca2+ sensitive K+ channel KCa3.1 promotes aggressive behavior of non-small cell lung cancer (NSCLC) cells and that

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej