Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

View All Documentation

EHU011991

Sigma-Aldrich

MISSION® esiRNA

targeting human FER

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GACACCTCATCATGGACACGCTACTTTAGCTAAGGCATGACCAGCAATGAACAGTAGTAAGATATGTGCTGATTAGAAGGCTCACTTGTGCAGTGTGGAGGATAACCAGTGCCTTACAAAATGGGGTTTGGGAGTGACCTGAAGAATTCACATGAAGCAGTGTTAAAATTGCAAGACTGGGAATTACGGTTACTGGAAACAGTAAAGAAATTTATGGCCCTGAGAATAAAAAGTGATAAAGAATATGCATCTACTTTACAGAACCTTTGTAATCAAGTTGATAAGGAAAGTACTGTCCAAATGAATTATGTCAGCAACGTATCCAAGTCTTGGCTACTTATGATTCAGCAGACAGAACAACTTAGTAGGATAATGAAGACACATGCAGAGGACTTGAACTCTGGACCTTTACACAGGCTCACCATGATGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000151422

numer dostępu NCBI

NM_005246

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... FER(2241) , FER(2241)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Ana Lonic et al.
The Journal of cell biology, 220(2) (2021-01-08)
Receptor degradation terminates signaling by activated receptor tyrosine kinases. Degradation of EGFR occurs in lysosomes and requires the switching of RAB5 for RAB7 on late endosomes to enable their fusion with the lysosome, but what controls this critical switching is
Yoav Elkis et al.
Nature communications, 8(1), 940-940 (2017-10-19)
Disruption of the reprogrammed energy management system of malignant cells is a prioritized goal of targeted cancer therapy. Two regulators of this system are the Fer kinase, and its cancer cell specific variant, FerT, both residing in subcellular compartments including
Joanna Stanicka et al.
Oncogene, 37(23), 3131-3150 (2018-03-16)
IGF-1 receptor (IGF-1R) and integrin cooperative signaling promotes cancer cell survival, proliferation, and motility, but whether this influences cancer progression and therapy responses is largely unknown. Here we investigated the non-receptor tyrosine adhesion kinase FES-related (FER), following its identification as

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej