Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

View All Documentation

EHU005381

Sigma-Aldrich

MISSION® esiRNA

targeting human MDM4

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTGGGACGTCAGAGCTTCTCCGTGAAAGACCCAAGCCCTCTCTATGATATGCTAAGAAAGAATCTTGTCACTTTAGCCACTGCTACTACAGATGCTGCTCAGACTCTCGCTCTCGCACAGGATCACAGTATGGATATTCCAAGTCAAGACCAACTGAAGCAAAGTGCAGAGGAAAGTTCCACTTCCAGAAAAAGAACTACAGAAGACGATATCCCCACACTGCCTACCTCAGAGCATAAATGCATACATTCTAGAGAAGATGAAGACTTAATTGAAAATTTAGCCCAAGATGAAACATCTAGGCTGGACCTTGGATTTGAGGAGTGGGATGTAGCTGGCCTGCCTTGGTGGTTTTTAGGAAACTTGAGAAGCAACTATACACCTAGAAGTAATGGCTCAACTGATTTACAGACAAATCAGGATGTGGGTACTGCCATT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000198625

numer dostępu NCBI

NM_002393

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MDM4(4194) , MDM4(4194)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Kehua Jiang et al.
Molecular genetics & genomic medicine, 7(8), e833-e833 (2019-06-30)
MicroRNA-33a (miR-33a) plays the role of the tumor suppressor gene by regulating the expression level of downstream genes. However, the effects of miR-33a in renal cell cancer (RCC) remain unknown. Our study was designed to investigate the expression level and
Haishan Zhang et al.
Molecular immunology, 125, 9-14 (2020-07-04)
MiR-483-3p is involved in the pathogenesis of acute myocardial infarctions, but its association with myocardial ischemia reperfusion (IR) remains mostly unknown. In this study, an in vitro model of myocardial IR injury was established by putting H9c2 cells into hypoxia
Hong Yan et al.
American journal of cancer research, 9(2), 312-329 (2019-03-25)
Activated KRAS is frequently observed and paralleled by inactivating of tumor suppressors in lung cancer, while the mechanisms remained elusive. Here, our study revealed a microRNA was involved in KRAS overexpression, activation of KRAS signaling and its synergy with inactivating
Yan Li et al.
Journal of molecular histology, 46(4-5), 357-364 (2015-06-21)
Multidrug resistance-associated protein 1 (MRP1) belongs to ATP-binding cassette transporters family. The overexpression of MRP1 is predominantly related with the failure of chemo-radiotherapy in various tumors. However, its possible role in hypertrophic scar (HS) is hardly investigated. Here we showed

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej